Question: how to design primers for IKBKG gene if it has pseudo gene?
0
gravatar for gskbioinfo143
3.3 years ago by
India
gskbioinfo14350 wrote:
Hi every one, I'm trying to design primers for IKBKG gene exon wise. Covering each exon region separately. But from exon 3 to 10 region its is having pesudo gene. I want primers specific to this target region not pseudo gene. How to design primers in this case. Hope to hear from you Thanks
primerdesign • 1.9k views
ADD COMMENTlink modified 3.3 years ago by Michael Dondrup46k • written 3.3 years ago by gskbioinfo14350
1
gravatar for Michael Dondrup
3.3 years ago by
Bergen, Norway
Michael Dondrup46k wrote:

Pseudo genes, as paralogues (defined on protein sequence similarity), are not necessarily a problem, only the level of DNA sequence identity is important. Do a full DNA-DNA alignment of the coding sequences and try to design primers using the sequences that are divergent enough, by specifying those unique regions as input to your primer designer. Do an in-silico PCR with the designed primers to detect other non-specific sites. 

In eprimer3, parameters 

-targetregion, -excludedregion, -includedregion
can be used to control this.

The -mispriminglibraryfile

parameter could be used to input sequences to avoid for amplification e.g. the coding sequence of the pseudogene.

Use -explain parameter to get an explanation in case no primer pair can be found.

ADD COMMENTlink modified 3.3 years ago • written 3.3 years ago by Michael Dondrup46k

IKBKG gene (exon 3 to exon 10) has pesudo gene. i have done blast and compared sequence but there is no chance of primer design specific to target region.

for example these primers covering IKBKG gene (exon 3 to exon 10) has pesudo gene. how to slove these issue and to design unique primers.

need help

AAGGGAGTGTTGAGACGCCATC

ACTGCATGGCCTAGCGAATGAC

thanks

ADD REPLYlink modified 3.3 years ago • written 3.3 years ago by gskbioinfo14350

What's the sequence identity at DNA level?

ADD REPLYlink written 3.3 years ago by Michael Dondrup46k

done similarity with blast, Sequence identity is 99%

ADD REPLYlink written 3.3 years ago by gskbioinfo14350

hey i got specific primers for these sequence covering 1,2,3-10 exons not exon wise its was tough

how to design primers for mrna coding region of the same sequence. covering UTR also or without UTRs

thanks

ADD REPLYlink written 3.3 years ago by gskbioinfo14350
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 740 users visited in the last hour