MicNeSs for SSR

Question

[####]

I am trying to use MicNeSs for predicting SSR in NGS reads.

But I am getting some error.

The error is :

/programs/MicNeSsv1.1.py", line 1226, in <module>
MyBeautifullSequences_allindiv = ReadFasta2( file )

programs/MicNeSsv1.1.py", line 189, in ReadFasta2
indiv = elt_titre[1]
IndexError: list index out of range

Can anyone help me, to solve this?

[Jean-Karim Heriche]

Barring a bug in the program, my guess is you have a badly formatted fasta file.

Answer 1

[####]

I first tried with NGS raw reads which looks like this:

@NS500223:130:HHVYWBGXX:1:11101:19179:1103 1:N:0:GATGAATC+AGATCTCG

CTCAAGAAGGTCCAGAAGGAGCTCGCCGACGTGGTGGGGCTTCACCGCCGGGTCGAGGAGTCTGACTTTGAGAAATTGACCTACCTAAAGTGCGTGATCAAGGAGACACTCCGCCTCCACCCGCCGATCCCCCTCCTCCTCCACGAGACG
+
AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEAAAAEEAEAAEAAEEEEEEAEEEEE

Then I tried with scaffold fasta sequence.

With both the options I am getting same error.

[Tej Sowpati]

The snippet you posted is of a FASTQ file, not FASTA. Is your scaffold file in the same format?

[####]

Yes,it is FASTQ format as the tool claims to predict SSR from raw reads.

While the scaffold file is in the following format:

>scaffold1

acatcagtacagtacagtcgacgcatcgcatagacatgactaagcatcacgacgcgtaggga

[Jean-Karim Heriche]

You seem to have an empty line between the header and the sequence. Could it be what's causing the error ? I think empty lines are not allowed in the middle of a fasta record so the sequence must immediately follow the header.

Answer 2

[####]

No. there is no space between header and sequence in the fasta file.