MicNeSs for SSR
2
0
Entering edit mode
6.0 years ago
#### ▴ 220

I am trying to use MicNeSs for predicting SSR in NGS reads.

But I am getting some error.

The error is :

/programs/MicNeSsv1.1.py", line 1226, in <module>
MyBeautifullSequences_allindiv = ReadFasta2( file )

programs/MicNeSsv1.1.py", line 189, in ReadFasta2
indiv = elt_titre[1]
IndexError: list index out of range

 

Can anyone help me, to solve this ?

NGS SSR MicNeSs • 1.4k views
ADD COMMENT
0
Entering edit mode

Barring a bug in the program, my guess is you have a badly formatted fasta file.

ADD REPLY
0
Entering edit mode
6.0 years ago
#### ▴ 220

I first tried with NGS raw reads which looks like this:

@NS500223:130:HHVYWBGXX:1:11101:19179:1103 1:N:0:GATGAATC+AGATCTCG

CTCAAGAAGGTCCAGAAGGAGCTCGCCGACGTGGTGGGGCTTCACCGCCGGGTCGAGGAGTCTGACTTTGAGAAATTGACCTACCTAAAGTGCGTGATCAAGGAGACACTCCGCCTCCACCCGCCGATCCCCCTCCTCCTCCACGAGACG
+
AAAAAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEAEAAAAEEAEAAEAAEEEEEEAEEEEE

Then I tried with scaffold fasta sequence.

With both the options I am getting same error.

ADD COMMENT
0
Entering edit mode

The snippet you posted is of a FASTQ file, not FASTA. Is your scaffold file in the same format?

ADD REPLY
0
Entering edit mode

Yes,it is FASTQ format as the tool claims to predict SSR from raw reads.

While the scaffold file is in the following format:

>scaffold1

acatcagtacagtacagtcgacgcatcgcatagacatgactaagcatcacgacgcgtaggga

ADD REPLY
0
Entering edit mode

You seem to have an empty line between the header and the sequence. Could it be what's causing the error ? I think empty lines are not allowed in the middle of a fasta record so the sequence must immediately follow the header.

ADD REPLY
0
Entering edit mode
6.0 years ago
#### ▴ 220

No. there is no space between header and sequence in the fasta file.

ADD COMMENT

Login before adding your answer.

Traffic: 2423 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6