gap filling solution
0
0
Entering edit mode
6.7 years ago
Bulbul Ahmed ▴ 20

It is the head of a big sequence. How will I remove the extra 1,2 from the sequence and fill the gap?

sequence • 1.8k views
ADD COMMENT
2
Entering edit mode

Please use complete words and sentences and take appropriate time to revise your question. Questions that are not intelligible may be closed for this reason.

ADD REPLY
1
Entering edit mode

Could you add detail and clarify your question?

ADD REPLY
0
Entering edit mode
@SRR1532157.1 1 length=100
______________^
GAAGTTTAGGCGGTGCATACGGAGCTGGC
+SRRSRR1532157.1 1 length=100
_________________^
GG>BGGGDEGGBGBGDFFFFGBGGBGGEG

the highlighted 1... how will I remove???

ADD REPLY
1
Entering edit mode

Ah, so we know for the first time it's fastq, and that you want to change the fastq record headers, and it has nothing to with 'gaps' in the sense the term is normally used in bioinformatics. Thanx ;)

ADD REPLY

Login before adding your answer.

Traffic: 1357 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6