error sequence arrived
1
0
Entering edit mode
8.5 years ago
Bulbul Ahmed ▴ 20
@SRR1532157.1 1 length=100
#_____________^
GAAGTTTAGGCGGTGCATACGGAGCTGGC
+SRRSRR1532157.1 1 length=100
#________________^
GG>BGGGDEGGBGBGDFFFFGBGGBGGEG

the highlighted 1... how will I remove?

sequence • 982 views
ADD COMMENT
1
Entering edit mode

Why do you need to? It's not a problem to have it there.

ADD REPLY
1
Entering edit mode
8.5 years ago
winter_li ▴ 60

I guess you meant you met an error when you dealed with SRA fastq format file . maybe because of unpaired reads? if so, should remove these reads!

ADD COMMENT

Login before adding your answer.

Traffic: 2524 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6