error sequence arrived

Question

[Bulbul Ahmed]

@SRR1532157.1 1 length=100
#_____________^
GAAGTTTAGGCGGTGCATACGGAGCTGGC
+SRRSRR1532157.1 1 length=100
#________________^
GG>BGGGDEGGBGBGDFFFFGBGGBGGEG

the highlighted 1... how will I remove?

[Devon Ryan]

Why do you need to? It's not a problem to have it there.

Answer 1

[winter_li]

I guess you meant you met an error when you dealed with SRA fastq format file . maybe because of unpaired reads? if so, should remove these reads!