Question: query using mysql on ucsc table browser
0
gravatar for bioguy24
4.2 years ago by
bioguy24190
Chicago
bioguy24190 wrote:

I have a folder of 57 text files each with 1000 locations in them.  I was going to use the mySQL browser at

mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A

but I am getting a connection error using ubuntu 14.04

cmccabe@DTV-A5211QLM:~$ mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A
ERROR 2003 (HY000): Can't connect to MySQL server on 'genome-mysql.cse.ucsc.edu' (110)

Basically, I am trying to run a query in refGene that will use each of the locations in all 57 files and return the sequences of the CDS plus 10 bases at either end.

Example output:

>hg19_refGene_NM_001305275_0 range=chr1:955543-955763 5'pad=10 3'pad=10 strand=+ repeatMasking=none
cgcctgcgccATGGCCGGCCGGTCCCACCCGGGCCCGCTGCGGCCGCTGC
TGCCGCTCCTTGTGGTGGCCGCGTGCGTCCTGCCCGGAGCCGGCGGGACA
TGCCCGGAGCGCGCGCTGGAGCGGCGCGAGGAGGAGGCGAACGTGGTGCT
CACCGGGACGGTGGAGGAGATCCTCAACGTGGACCCGGTGCAGCACACGT
ACTCCTGCAAGgtgcgcccac
>hg19_refGene_NM_001305275_1 range=chr1:957571-957852 5'pad=10 3'pad=10 strand=+ repeatMasking=none
tccaccccagGTTCGGGTCTGGCGGTACTTGAAGGGCAAAGACCTGGTGG
CCCGGGAGAGCCTGCTGGACGGCGGCAACAAGGTGGTGATCAGCGGCTTT
GGAGACCCCCTCATCTGTGACAACCAGGTGTCCACTGGGGACACCAGGAT
CTTCTTTGTGAACCCTGCACCCCCATACCTGTGGCCAGCCCACAAGAACG
AGCTGATGCTCAACTCCAGCCTCATGCGGATCACCCTGCGGAACCTGGAG
GAGGTGGAGTTCTGTGTGGAAGgtgcgtggtg

I am not sure what is wrong or what query to use as AI have never used this tool.  Thank you :).

ucsc mysql next-gen sequence • 1.4k views
ADD COMMENTlink modified 4.2 years ago by Emily_Ensembl20k • written 4.2 years ago by bioguy24190
1

works for me.

$ mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A -D hg38 -e 'select now();
+---------------------+
| now()               |
+---------------------+
| 2016-01-19 09:29:40 |
+---------------------+

check your proxy settings?!!

ADD REPLYlink modified 3 months ago by RamRS26k • written 4.2 years ago by Pierre Lindenbaum127k
1

to get the fasta sequence: you're looking for tabix , or twoBitToFa see How To Get The Sequence Of A Genomic Region From Ucsc?

ADD REPLYlink written 4.2 years ago by Pierre Lindenbaum127k

Looks like it is the proxy settings... thank you :).

ADD REPLYlink written 4.2 years ago by bioguy24190
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 993 users visited in the last hour