Question: Cutadapt paired end reads with 1 adapter list fasta
0
gravatar for umn_bist
3.6 years ago by
umn_bist330
umn_bist330 wrote:

Is it safe to feed the same adapter list for both forward and reverse strands (for paired end reads)? In other words, will the tool automatically reverse the adapters for the reverse strand?

cutadapt --quiet -q 10,10 -aA /Volumes/My\ Passport/Documents/adapters.fa -o out_1.fastq -p out_2.fastq in_1.fastq in_2.fastq

I purposefully left out -O command (min overlap length, of 25) because the overrepresented Kmers in my FastQC report showed 6 bp sequences commonly found in TruSeq adapters. The default min overlap is 3 bp.

Also, in an example pipeline, I found these (bolded) commands that I could not understand why it was necessary.

ls *R1_001.fastq | parallel -j $PARALLEL_TASKS "cutadapt -q 10,10 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -O 25 {} 2> {.}.cutadapt | sed 's/^$/C/g' > {.}_adapt.fastq​
cutadapt rna-seq illumina • 1.5k views
ADD COMMENTlink modified 3.6 years ago by dariober10k • written 3.6 years ago by umn_bist330
3
gravatar for dariober
3.6 years ago by
dariober10k
WCIP | Glasgow | UK
dariober10k wrote:

Is it safe to feed the same adapter list for both forward and reverse strands (for paired end reads)? In other words, will the tool automatically reverse the adapters for the reverse strand?

I remember checking this and the answer is yes, you can use the same sequence. I think you should also check the trimming report, read 1 and read 2 should have similar stats.

ADD COMMENTlink written 3.6 years ago by dariober10k

Thank you for your reply, dariober. For projects dealing with 100+ samples, is it still common practice to manually verify the quality of pre-,post-alignment QC reports?

EDIT: Should I only use the -a (for forward adapter) and leave -A (for reverse adapter) out if cutadapt automatically flips the adapter sequence for the paired file?

ADD REPLYlink modified 3.6 years ago • written 3.6 years ago by umn_bist330
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1846 users visited in the last hour