Cutadapt paired end reads with 1 adapter list fasta
1
0
Entering edit mode
5.7 years ago
umn_bist ▴ 390

Is it safe to feed the same adapter list for both forward and reverse strands (for paired end reads)? In other words, will the tool automatically reverse the adapters for the reverse strand?

cutadapt --quiet -q 10,10 -aA /Volumes/My\ Passport/Documents/adapters.fa -o out_1.fastq -p out_2.fastq in_1.fastq in_2.fastq

I purposefully left out -O command (min overlap length, of 25) because the overrepresented Kmers in my FastQC report showed 6 bp sequences commonly found in TruSeq adapters. The default min overlap is 3 bp.

Also, in an example pipeline, I found these (bolded) commands that I could not understand why it was necessary.

ls *R1_001.fastq | parallel -j $PARALLEL_TASKS "cutadapt -q 10,10 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCAC -O 25 {} 2> {.}.cutadapt | sed 's/^$/C/g' > {.}_adapt.fastq​
RNA-Seq cutadapt Illumina • 2.0k views
ADD COMMENT
3
Entering edit mode
5.7 years ago

Is it safe to feed the same adapter list for both forward and reverse strands (for paired end reads)? In other words, will the tool automatically reverse the adapters for the reverse strand?

I remember checking this and the answer is yes, you can use the same sequence. I think you should also check the trimming report, read 1 and read 2 should have similar stats.

ADD COMMENT
0
Entering edit mode

Thank you for your reply, dariober. For projects dealing with 100+ samples, is it still common practice to manually verify the quality of pre-,post-alignment QC reports?

EDIT: Should I only use the -a (for forward adapter) and leave -A (for reverse adapter) out if cutadapt automatically flips the adapter sequence for the paired file?

ADD REPLY

Login before adding your answer.

Traffic: 1029 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6