Question: bwa mem: paired end reads have different names: Issue with 0.7.10
0
gravatar for ARB
3.1 years ago by
ARB90
United States
ARB90 wrote:

Hi all, 

I am trying to run alignments for paired end MiSeq data and I am getting this error:

"
[mem_sam_pe] [mem_sam_pe] [mem_sam_pe] paired reads have different names: "M03721:10:000000000-AH7UG:1:1101:16268:1596", "M03721:10:000000000-AH7UG:1:1101:16959:1596"

paired reads have different names: "M03721:10:000000000-AH7UG:1:1101:13391:1606", "M03721:10:000000000-AH7UG:1:1101:17720:1609"

[mem_sam_pe] paired reads have different names: "M03721:10:000000000-AH7UG:1:1101:16099:1561", "M03721:10:000000000-AH7UG:1:1101:17123:1563"
[mem_sam_pe]
"


I tried sorting my fastq, also ran the repair.sh tool from BBtools, but nothing seems to work. 

Here is the command I am using:

~/bin/0.7.10/bwa mem -M -v 1 -t 24 -R $readGroup -p $fasta 1.fastq 2.fastq 1> raw.sam 2> Logs_bwaAlign.txt

I am using 0.7.10 bwa for alignment. However, when I use an older version such as 0.7.5a or newwer version like 0.7.12, I do not get this error and alignments works fine. This is only the issue with 0.7.10 and it really baffles me. I cant seem to figure what is the issue here. If you can help me understand whats going on here, that would be great.

Thank you so much in advance.

Ashini

 

Here are the first few reads from my fastq (that are giving issues) for anyone to look. I cant seem to find an attachment option, so pasting it here.

1.fastq:

@M03721:10:000000000-AH7UG:1:1101:15914:1524 1:N:0:3
TTTGTGTGCTGGGTTACAGAGCCACACCACTCATCCCTAGCCTTGTCATGTTAGCTATCCATTCTGTCTAACGTAGTGGCTTATCCCAAACCTTAGTGGTTTAAAACTTATCCCCAAAGTTAATGTGGTTTAAAAGAACAACATGCTGGCC
+
>>A1A1C1DFB11FF1B3111BF0EFEEAFHHBFGGGFB0EEGD1GFFGFGHB1AF2D0F2FEGHGHFH22F/B00F00AGFFHFE@100??FG11BF0GFE@2111FF1FGFFC0/00BF22BBB21BFG12111/0<B0//B11FB1<<
@M03721:10:000000000-AH7UG:1:1101:17949:1533 1:N:0:3
TGTAATACACGGCCGTGTCCTCAGATCTCAGGCTGCTCAGCTCCATGTAGGCTGTGCTCGTGGATTTGTCCGCGGTAATCGTGACTCTGCCCTGGAACTTCTGTGCGTAGTTTGCTATACCAAGGATAGGGATGATCCTTCCCATCCACTT
+
11>11D3D1C11AA0E0FFFGF111DCFF220AF0FGDB0BFFF1F1FB21BFCG0AF1/EA//BGG1DFF/>//>//BF/F00?FBF1@EEG0/01BGHDE1B21/?//FEFB>F2B2BF110/0B11000B/1@GFGHFFF1@FC1FF1
@M03721:10:000000000-AH7UG:1:1101:17725:1536 1:N:0:3
TAGTTCGGGCCCTGGGGTCTTGCTGGGGCCCATAGGCATGTGGGGCAGGAAGCTGGGCAGAGCTGGCCTGGCTCTGAGTGGCCACTGGGGGAAAGGCAGCCTTCTGTCTGCCAATCTGGGTAGGCCCAGTGGCCAAGCTCTCATGGGAGAG
+
>11>AD111>A@GA000AEEG1AF1100AAA/G011E1FAFE1//A/A//00AF10/E0///>F10?BG//BGEGB11G1/>F1?F10//////00?0??F0FC<1BBF1>B11@FG210@1//1@?//?10?<1//<><=<1=11.0>..
@M03721:10:000000000-AH7UG:1:1101:17080:1536 1:N:0:3
TTTTTGTCTTTTGTTGTTGTTCAAACGGGATTCACAGAGTATTTGAAAAATGTATATATATTAAGAGGTCACGGGGGCTAATTGCTGGCTGGCTGCCTTTTGCTGTGGGGTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
+
1>AAA1CDFFFFCGGCGGAFGEB33FA?C0BGG1D211AF2DGHB21110BEF2F2FEF2GG22A11/FG1B/////EEC1BG21GB1EF//?FCEGGHHHBDFDF0B/?ECEF201BF/////00@1<0</??G/1<1FF<11?<11>G1
@M03721:10:000000000-AH7UG:1:1101:13934:1558 1:N:0:3
TAGCTGCTCCCCAGACAAGCAGTGCATGTGAGCAGCTGGGATGCCACAGGAGGGAGGTTTCTTTTGGGGGCTGTACCACTGTGGGAGGAGTTTGTAGAGCTTGCATGCAGTGATAAACCCCAACATCTTCAGCCTCCACCCGGCTNNNNNN
+
111>A1CCDFAAB?1FB11EC0FBFBGBGBDEFDBFGGB?AGCGGFGF0A0/A?/A?EGHHHHHH1////EE?GEGHBGHFHGFC/C///GHHBHFD2DEGGBE1GBG1DGB1F221BCECCCC/FGHHG21@FHHHBFGF//<A/01FF.
@M03721:10:000000000-AH7UG:1:1101:17966:1558 1:N:0:3
TTTTCTTTGTCTACAATATGGGAAGAGCCCTGGTTTTGCCTGCTTCCAGGGCTATTGTGAGATCAAAGGAAAGAATGCAAGTGCAAGAGTTTTGAGGACAGCAACATCCTATTTGGCTTTGAATTATTAATATGACTTGCTTAAAAGTTTA
+
1>AAAFFF3FFF3B11F1F31111A000BFH00FGHF0AFHBGGHHFE10/BF0BG1G2211BFCB11B00B00BB1F111FD1A1100DGGH0//01B0>/0000BFGHDGHG21@GEG121BF1FD22B2B>2BFG11BB21111FGH2
@M03721:10:000000000-AH7UG:1:1101:16099:1561 1:N:0:3
TAATAAAAAATATGTATATAATAAATTATTGTTGACTATGGTCACCCTGTTATGCTAATACTAGATCTTATTCACTCTATATTTTTGCACTCATTAACCATCTATACTTTTTCCCCCATCCCCACTACCCTTCCCAGTCTCTGGNNNNNNN
+
111>1@D111C1GBG3F3FDFGB31DGBGHDHHFBGHCH21FGCHGGHFHHEHEFHBFHFFG2A1FFGH2FGD2DHGHGHFHHHHH/12ABGBGHFEEF1F@G1F2FGHHHHHFGFE?GGCGF0EG0FCCEGHF011FBGHH11101FGA/
@M03721:10:000000000-AH7UG:1:1101:17123:1563 1:N:0:3
TACCATGTTCAATGATTTCAACTAAACTTCTAAGATGTGGCAAGATGGCACAGCCCATAAGAATAGCTATCTGTTGTACAATCTTAATACCAGTGTGTCTCGCTTGCCAGGACTTCTTGCTTTTGCACACAGCTTTTAAGAAGGGCAATAA
+
>1>>>DDFFFBFGG1GGGG3DGHFB1FGHFHFBEFGBG11A0100GFFGFF00FGE/F01111FAFFGBFGH2GG1FFGHEHHHHEBGBGGE1FCFFHHHD0FFHFGEF1//?FHGHHBFHHHH1DBF1F/0?GHHHE111100/</<G11

2.fastq:

@M03721:10:000000000-AH7UG:1:1101:15914:1524 2:N:0:3
CTCGGCCTCCCAATGTGCTGGGTCTACAGGCATGAGCCACCATGCCTTGCCAGCATGTTGTTCTTTTAAACCACTTTCACTTTGGGGCTAAGTTTTAAACCACTAAGGTTTGGGATAAGCCACTACGTTAGACAGACTTGATAGCTAACAT
+
1>>1111>11>1111B33B11000B1A11000B011A00AB0B1A1A11BA11/0B1DF2BF1FGHH211AA/A11B12BDFG10///>011BFGH21@10/>B0110BFG////B0111>0>B00/BF0/111000B211>22>B2101B
@M03721:10:000000000-AH7UG:1:1101:17949:1533 2:N:0:3
TGTTGTTGGTTTGGATCATCCCTCTCCTTGGTATAGCTATCTACTCACTGAAGTTCCAGGTCTGAGTCACGTTTACCGCGGTCTAATCCACTAGCACAGCCTACATGGAGCTGTGCTGCCTTAGATCTTTGGTCCCTGCCGTGTCTTACTT
+
11>111>11111111BA1B3AAA0BA0BG11B1D221222AD21211111111DG2A2101B1011D111/00B/11///////12B@B1@10101100/>B1B1@2010>>110121BB>1111B>B1210/11011/</?/B0BB21>2
@M03721:10:000000000-AH7UG:1:1101:17725:1536 2:N:0:3
CTCCCATTATTGCTTTGCCACTTGGCCTACCCAGATTGGCAGACAGACGTCTGCCTTTCCCCCAGTGGCCACTCAGATCCATGCCAGCTCTTCCCAGCTTCCTGCCCCACATGCCTTTGGGCCCCCGCTAGACCCCTGGCCCCGAACTCAT
+
1>>>>1B133333BF31111BB1111AB0BBA100BF10A100A0000//AA/1AFFG1AAAB//B10/A1AB00112@11211111/B@F1@B>110BF11B1@B/?/>/B1B1>1B10/0/<///<///111??///00?<///>?111
@M03721:10:000000000-AH7UG:1:1101:17080:1536 2:N:0:3
TTTACCCCTCTTCAACATGCAGCCTGCCCGCAATTAGCCCCCGTTCCCTCTTAATATATATACATTTTTCAAATTCTCTGTTAATCCCGTTTGAACAACAACACAAGACCACACAGTTCGGCATTGCTTCGTTTTGGGATTGTGTGTATAT
+
1111>1111>11A3131111111A000B00000BB110AAAA/A00AABAFA12A2D2D2D2B2DADAG0222D1@@2D1B222D2@B/BBF/11@10////////00>00//>/01>2/////1112>1/<0?/0///10012<0<2222
@M03721:10:000000000-AH7UG:1:1101:13934:1558 2:N:0:3
CGCCGGGTGGAGGCTGAAGATGTTGGGGTTTATCACTGCATGCAAGCTCTACAAACTCCTCCCACAGTGGTACAGCCCCCATAAGAAACCTCCCTCCTGTGGCATCCCAGCTGCTCACATGCACTGCTTGTCTGGGGAGCAGCTCNNNNNN
+
11>>111>10000AA00BA1B1DD200AEEEFHF2FG1A1D2B111ABBG1B111AFCGGFFE0B/0B10D2B12B>??//0011110BBGE?EGFEH1B10?0B>FC11<B11BF1<1B1<1BF0BFF1BFF100///</0??F101??/
@M03721:10:000000000-AH7UG:1:1101:17966:1558 2:N:0:3
TCCTAGCACATCTTGGATTAGTCTCGTAATAAACTTTTATGCTCGTCATATTAATAATTCAAAGCCAAATAGTATTTTTCTGTCCTCTAATCTCTTGCACTTGCATTCTTTCCTTTGATCTCTCACTTTCCCTGGAATCATGCAAAACCAT
+
111>11@111113B311BB11B3B30A00B33A1BGFF2121210AA0A2DB22B22ADB122100B00A1122DDAF1AD2AAAFA11121BDEG1111BF111BGFEEGD@GGF12@@F22B11B1111B@1/0111121111100?/1
@M03721:10:000000000-AH7UG:1:1101:16099:1561 2:N:0:3
CCAGAGACTGGGAAGGGTAGTGGGGATGGGGGAAAAAGTATAGATGGTTAATGAGTGCAAAAATATAGAGTGAATAAGATCTAGTATTAGCATAACAGGGTGACCATAGTCAACAATAATTTATTATATACATATTTTTTATTTNNNNNNN
+
1>11111>B11111111F10B00000B0000/A//00/B2D222D21BGB1GB2AFDDF110/B1F2221F112D2111DBG11F2GHD2B@GB@FB1//FA/BFEG11GGB2B1/B>1FGH2FG2GBG2>2F2FHHHGGEHHHB21B>//
@M03721:10:000000000-AH7UG:1:1101:17123:1563 2:N:0:3
CTGGATGAGTATGTCCGTAACACAACAGCTAGAGCTTTTGCTGTTGTATCCTCTGCCCTGTGCATTCCTTCTTTATTGCCCTTCTTAAAAGCTGTGTGCAAAAGCAAGAAGTCCTGTCAAGCGAGACACACTGGTCTTAAGATTGTACAAC
+
1>111B111B3@3BAB1F11A1B00A00BFAF111BGHH11F1DF1B12D2FDG11FFF01112DGFAAEDGHH2FG1AABFF0FG22111>F1D0F0D21100>100000BB@G11@221@////>0B0?B10B1BF2211BF1B2>211

 

bwa alignment • 3.0k views
ADD COMMENTlink modified 3.1 years ago • written 3.1 years ago by ARB90
1
gravatar for SES
3.1 years ago by
SES8.1k
Vancouver, BC
SES8.1k wrote:

Try the command without the "-p" or interleave the pairs (the "-p" says to ignore the 2.fastq file). Also, you can just post one or a couple of records next time instead.

ADD COMMENTlink written 3.1 years ago by SES8.1k
0
gravatar for ARB
3.1 years ago by
ARB90
United States
ARB90 wrote:

I am already using the -p flag in my alignment. 

~/bin/0.7.10/bwa mem -M -v 1 -t 24 -R $readGroup -p $fasta 1.fastq 2.fastq 1> raw.sam 2> Logs_bwaAlign.txt

I apologize for pasting so many records. I will keep that in mind next time. 

Thanks.

 

ADD COMMENTlink modified 3.1 years ago • written 3.1 years ago by ARB90

SES said to NOT use -p. This option is for "smart pairing":

-p
Smart pairing. If two adjacent reads have the same name, they are considered
to form a read pair. This way, paired-end and single-end reads can be mixed
in a single FASTA/Q stream

As you have proper paired files, you do not want to use -p.

ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by h.mon24k
0
gravatar for ARB
3.1 years ago by
ARB90
United States
ARB90 wrote:

Oops, my bad. I misread it. I removed it and it worked. Thank you so much SES and h.mon. 

 

ADD COMMENTlink written 3.1 years ago by ARB90
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1091 users visited in the last hour