How to remove adapters using Trimmomatic software?
2
1
Entering edit mode
6.8 years ago
sukesh1411 ▴ 30

Hi,

I am the beginner to perform RNA Seq analysis. I installed FASTQC and submitted the RNA sequence to check the quality of the sequence. Over represented sequences are observed in FASTQC analysis. I tried to remove it using the Trimmomatic tool. I installed and submitted fastq file to remove the over represented sequences. But I could not remove those over represented sequences. Can anyone help me to remove these adapters in fastq file?

Overrepresented sequences

Sequence                                        Count     Percentage            Possible Source
ATGATGAGATCGTTCAGTACGGCAAAAAAAAAAAAAAAAAAAAA    102956    3.856180165819193     No Hit
ATGATGAGATCGTTCAGTACGGCAATAAAAAAAAAAAAAAAAAA    76284     2.8571899429790526    No Hit
ATGATGAGATCATTAGTTGAAAGCCGAAAAAAAAAAAAAAAAAA    68466     2.5643695484767948    No Hit
ATGATACCCGTAATCTTCATAATCCGAGAAAAAAAAAAAAAAAA    67906     2.5433949487171037    No Hit
ATGATATTATGCACATTTTCTAGTTCAAAAAAAAAAAAAAAAAA    60988     2.2842837324000635    No Hit
ATGATTCATCAGGCCATAGCTGTCCAAAAAAAAAAAAAAAAAAA    33121     1.2405352118584394    No Hit
ATGACATGACACTGATTAGGGATGTGAAAAAAAAAAAAAAAAAA    29486     1.1043875866325878    No Hit
ATGATACCCGTAATGTTTCCGCTGAGAAAAAAAAAAAAAAAAAA    27382     1.0255830189640345    No Hit
ATGACACCCGTACATATGTTTCCGTGCTAAAAAAAAAAAAAAAA    27230     1.0198899133149757    No Hit
ATGATACCCGTATAAGTTTCTGCTGAGAAAAAAAAAAAAAAAAA    26507     0.9928102068395173    No Hit
ATGATAATACGTCGTTGGTGTTTCCATAAAAAAAAAAAAAAAAA    25893     0.9698130563887133    No Hit
ATGATGAGGTAGGCTCAGTAGATGCGAAAAAAAAAAAAAAAAAA    17423     0.6525722350233867    No Hit
ATGAGAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA    16971     0.6356427366459217    No Hit
ATGATACAAAGTATTTGAAAAGTCGTGCAAAAAAAAAAAAAAAA    15294     0.5728313012941
RNA-Seq • 6.8k views
ADD COMMENT
0
Entering edit mode

It is good to post the exact command line you used with the options so people can get an idea of how you ran trimmomatic. It is possible to use an incorrect option (or an option incorrectly), when you are a new user.

ADD REPLY
0
Entering edit mode

Hi sir,

Thanks for your reply sir. I am not sure whether the command is correct or not? Is there any adapter file we must provide while running the command sir?

Command I used to run trimmomatic is

java -jar trimmomatic-0.35.jar SE -phred64 SRR514378.fastq output1P.fa ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36

the input sequence is SRR514378.fastq.

output

trimmomaticSE: Started with arguments:

 -phred64 SRR514378.fastq output1P.fa ILLUMINACLIP:TruSeq3-PE.fa:2:30:10 LEADING
:3 TRAILING:3 SLIDINGWINDOW:4:15 MINLEN:36
Automatically using 4 threads
Using PrefixPair: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTG
TGCTCTTCCGATCT'
ILLUMINACLIP: Using 1 prefix pairs, 0 forward/reverse sequences, 0 forward only
sequences, 0 reverse only sequences
Input Reads: 2669896 Surviving: 0 (0.00%) Dropped: 2669896 (100.00%)
TrimmomaticSE: Completed successfully.

Though job is running successfully sir, I could not filter the adapters. Can anyone help me to remove the adapters using trimmomatic software

ADD REPLY
0
Entering edit mode
6.8 years ago
sukesh1411 ▴ 30
ADD COMMENT
0
Entering edit mode
6.8 years ago
Martombo ★ 3.0k

The adapter file is the one you specified in this part of your command: TruSeq3-PE.fa

In this file there are the two following sequences: 'TACACTCTTTCCCTACACGACGCTCTTCCGATCT' and 'GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT'

The reason why they are not modifying your file is that they are not present in it (at least in these over-represented sequences you show).

What you might want to remove, instead, is the series of 'A's you have at the end of your sequences.

PS: why are all your reads starting with 'ATG'? did you use some special kind of library preparation?

PPS: if you use MINLENGHT:36 you are only going to keep reads longer than 36bp, which might not be what you want.

ADD COMMENT

Login before adding your answer.

Traffic: 2788 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6