Errors in sam file after bwa SAMPE alignment.

Question: Errors in sam file after bwa SAMPE alignment.

3.1 years ago by

United States

kirannbishwa01 • 950 wrote:

I aligned my fasta files to the reference genome using bwa sampe.

I have paired end reads so first used:

bwa aln -t 2 -l 20 lyrata_genome.fa Trm_MA605_R1.fastq > Trm_MA605_R1.sai
bwa aln -t 2 -l 20 lyrata_genome.fa Trm_MA605_R2.fastq > Trm_MA605_R2.sai

Then I did the sampe alignment using:

bwa sampe -n 1 -N 2 lyrata_genome.fa Trm_MA605_R1.sai Trm_MA605_R2.sai Trm_MA605_R1.fastq Trm_MA605_R2.fastq > SAMPEaligned_MA605readsBWA.sam

I tried to sort the alignment and convert it to bam using picard. But, getting the error message (part of the total error message):

Exception in thread "main" htsjdk.samtools.SAMFormatException: Error parsing text SAM file. MAPQ should be 0 for unmapped read.; File SAMPEaligned_MA605readsBWA.sam; Line 673702
Line: HWI-ST588:81:C080WACXX:7:1102:6980:187157   69   4   23328260   6   84M   6   963719   0   GGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGCATAAA   +2AAEEEIIFFIFIEI<CEDCEDDDDDIIIBDDEIDDBDDEIIDCCDIIII=ADDDDD?@DAAAAA>?AAAA>??AAA35(54>   RG:Z:MA605_C080WACXX_7   XT:A:U   NM:i:3   SM:i:6   AM:i:6   X0:i:1   X1:i:55   XM:i:3   XO:i:0   XG:i:0   MD:Z:28C49A1A3
   at htsjdk.samtools.SAMLineParser.reportErrorParsingLine(SAMLineParser.java:439)
   at htsjdk.samtools.SAMLineParser.parseLine(SAMLineParser.java:341)
   at htsjdk.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:248)

I tried to validate the sam file using picard again:

java -jar /home/everestial007/picard-tools-1.139/picard.jar ValidateSamFile I=SAMPEaligned_MA605readsBWA.sam Mode=VERBOSE MAX_OUTPUT=15000 O=validatebamMA605forGATK

But, gettin the following error message in the output file.

ERROR: Record 46, Read name HWI-ST588:81:C080WACXX:7:1101:3935:2321, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 155, Read name HWI-ST588:81:C080WACXX:7:1101:9306:2386, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 352, Read name HWI-ST588:81:C080WACXX:7:1101:20820:2318, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 382, Read name HWI-ST588:81:C080WACXX:7:1101:2880:2595, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 562, Read name HWI-ST588:81:C080WACXX:7:1101:10717:2694, Mate negative strand flag does not match read negative strand flag of mate
ERROR: Record 603, Read name HWI-ST588:81:C080WACXX:7:1101:12062:2750, Mate negative strand flag does not match read negative strand flag of mate

I followed the bwa manual to letter but getting this kind of errors. I can not figure why is my alignment not working.

Thanks in advance.

bwa bam sam picard genome • 2.0k views

ADD COMMENT • link •

modified 3.1 years ago by Devon Ryan ♦ 88k • written 3.1 years ago by kirannbishwa01 • 950

3.1 years ago by

Devon Ryan ♦ 88k

Freiburg, Germany

Devon Ryan ♦ 88k wrote:

Try adding VALIDATION_STRINGENCY=LENIENT to your picard commands. Picard takes a very strict view of what a proper SAM file should be (including enforcing rules that aren't in the specification).

ADD COMMENT • link modified 3.1 years ago • written 3.1 years ago by Devon Ryan ♦ 88k

Thanks for the info. But, should not we be considering the error message. I don't understand what "Mate negative strand flag does not match read negative strand flag of mate" means, and if I should be concerned that my alignments are working properly or not. Btw, sam flagstat reports that 86 % of the reads are aligned - so it is something cocerning.

Thanks,

ADD REPLY • link written 3.1 years ago by kirannbishwa01 • 950

It's possible that your mates are out of sync (i.e., the nth read in Trm_MA605_R1.fastq doesn't match the nth read in Trm_MA605_R2.fastq), so you might check that (you can use reformat from BBMap to do this).

ADD REPLY • link written 3.1 years ago by Devon Ryan ♦ 88k

Thanks for the info. I a little hesistant in trying to learn a new tool again (just takes too much of my time to set it up to getting it right), but will do it as a last resort. Do you think picard can do it? Also, if if have 86% alignment, should I be worried about it? - just wanting to weigh the pros and cons of the extra step, but I will appreciate any suggestions.

Thanks,

ADD REPLY • link written 3.1 years ago by kirannbishwa01 • 950

If the overwhelming majority are marked as "proper pairs" then I wouldn't bother with further processing, the results are likely fine.

ADD REPLY • link written 3.1 years ago by Devon Ryan ♦ 88k

Thanks for enlighting. Here is my samtools flagstat report,

22193026 + 0 in total (QC-passed reads + QC-failed reads)
0 + 0 secondary
0 + 0 supplementary
0 + 0 duplicates
19848288 + 0 mapped (89.43% : N/A)
22193026 + 0 paired in sequencing
11096513 + 0 read1
11096513 + 0 read2
18519235 + 0 properly paired (83.45% : N/A)
19450790 + 0 with itself and mate mapped
397498 + 0 singletons (1.79% : N/A)
366420 + 0 with mate mapped to a different chr
122636 + 0 with mate mapped to a different chr (mapQ>=5)

Since, 83.45% are properly paired so I think I am good to go, but just want to make sure. Also, I used picard's "CleanSam" to remove reads that mapped out of reference sequence.

ADD REPLY • link written 3.1 years ago by kirannbishwa01 • 950

That seems reasonable, you should be good to go.

ADD REPLY • link written 3.1 years ago by Devon Ryan ♦ 88k

Similar posts • Search »