Question: I can't convert the sam file to fastq file.
0
gravatar for porori3000
3.1 years ago by
porori30000
porori30000 wrote:

First of all, I'm a student innon-English-speakingcountry... Newbie in bioinformatics.I'm working at the Ubuntu circumstance.

My object is to make a artificial fastq files (paired-end) from human chromosome 1(GRCh37) reference data.

Using SimSeq, I made a sam file. Used command is this.

java -jar -Xmx2048m /(Path)/SimSeq.jar -1 100 -2 100 \
          --insert_size 500 \
          --insert_stdev 200 \
          --read_number 12462531 \
          --reference /(Path)/chr1.fa \
          --out /(Path)/output.sam

One sam file was made, and I think this sam file includes paired end data.

And Next step, Using picard SamToFastq.jar, I want to make fastq files from the sam file. But I stopped at here. Used command is this.

java -jar /(Path)/picard-tools-1.119/SamToFastq.jar \
         I=/(Path)/output.sam \
         FASTQ=/(Path)/output_1.fastq \
         SECOND_END_FASTQ=/(Path)/output_2.fastq

It throws an error message.

[Wed Feb 17 18:34:10 KST 2016] picard.sam.SamToFastq INPUT=/(Path)/output.sam FASTQ=/(Path)/output_1.fastq SECOND_END_FASTQ=/(Path)/output_2.fastq  OUTPUT_PER_RG=false RE_REVERSE=true INTERLEAVE=false INCLUDE_NON_PF_READS=false READ1_TRIM=0 READ2_TRIM=0 INCLUDE_NON_PRIMARY_ALIGNMENTS=false VERBOSITY=INFO QUIET=false VALIDATION_STRINGENCY=STRICT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false
            OpenJDK 64-Bit Server VM warning: You have loaded library /(Path)/picard-tools-1.119/libIntelDeflater.so which might have disabled stack guard. The VM will try to fix the stack guard now.
            It's highly recommended that you fix the library with 'execstack -c <libfile>', or link it with '-z noexecstack'.
            [Wed Feb 17 18:34:10 KST 2016] Executing as (my account)@(server name) on Linux 3.16.0-031600-generic amd64; OpenJDK 64-Bit Server VM 1.7.0_75-b13; Picard version: 1.119(d44cdb51745f5e8075c826430a39d8a61f1dd832_1408991805) IntelDeflater
            [Wed Feb 17 18:34:10 KST 2016] picard.sam.SamToFastq done. Elapsed time: 0.00 minutes.
            Runtime.totalMemory()=1011351552
            To get help, see http://picard.sourceforge.net/index.shtml#GettingHelp
            Exception in thread "main" htsjdk.samtools.SAMFormatException: Error parsing text SAM file. Empty sequence dictionary.; Line 1
            Line: SimSeq_1 83 gi|224384768|gb|CM000663.1| 95867799 255 100M = 95867511 -388 ACATGCACAGTGCACATACACATTTGTATGTATCTAGTTATCATGTATATTTATTTAAATTTCACAAATGATGAATAACCATAGAAAAATAAACAGATAA ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ YC:Z:100M
             at htsjdk.samtools.SAMLineParser.reportErrorParsingLine(SAMLineParser.java:427)
             at htsjdk.samtools.SAMLineParser.parseLine(SAMLineParser.java:331)
             at htsjdk.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:247)
             at htsjdk.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:235)
             at htsjdk.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:211)
             at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:514)
             at htsjdk.samtools.SamReader$AssertingIterator.next(SamReader.java:488)
             at picard.sam.SamToFastq.doWork(SamToFastq.java:149)
             at picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:183)
             at picard.sam.SamToFastq.main(SamToFastq.java:137)

How can I fix the problem and can make a fastq file?

sam fastq • 1.8k views
ADD COMMENTlink modified 5 months ago by RamRS20k • written 3.1 years ago by porori30000

Hi,

Try running Picard again with this added parameter -

VALIDATION_STRINGENCY=LENIENT

ADD REPLYlink modified 5 months ago by RamRS20k • written 3.1 years ago by Amitm1.6k
1
gravatar for Pierre Lindenbaum
3.1 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum118k wrote:

(your picard tools is old)

I'm pretty sure that running

head output.sam

will show reads, but no header.

ADD COMMENTlink modified 5 months ago by RamRS20k • written 3.1 years ago by Pierre Lindenbaum118k

thanks for your advice. I added two lines:

@HD VN:1.0 SO:coordinate
@SQ SN:gi|224384768|gb|CM000663.1|  LN:249904550

on the first part of the sam file and do the same command. It still print the warning message about Server VM warning and fixing library recommendation but it works anyway!

ADD REPLYlink modified 5 months ago by RamRS20k • written 3.1 years ago by porori30000
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1894 users visited in the last hour