Question: Bowtie2 (ERR): bowtie2-align exited with value 1
0
gravatar for s-root
4.0 years ago by
s-root0
s-root0 wrote:

Hi

I'm fairly new to next gen sequencing data analysis and am having some issues with Bowtie2 alignment. It was working fine up until a little while ago but has been giving the following error recently: (ERR): bowtie2-align exited with value 1. I get this error if I run my bowtie2 command:

$ bowtie2 -x /path/to/genome -U /path/to/fastq |samtools view -bhS - | samtools sort - aligned_file

(followed by an Abort! )and also when I just run bowtie2 ($ bowtie2) without any parameters. Because of the latter, I thought this was an installation problem, so I re-installed the program, but it still gives me the same error. Any thoughts on what the problem is and how to fix it?

Thanks!

chip-seq alignment bowtie2 • 16k views
ADD COMMENTlink modified 17 months ago by RamRS25k • written 4.0 years ago by s-root0

Is that the entire error message?

ADD REPLYlink written 4.0 years ago by jotan1.2k
0
gravatar for Antonio R. Franco
4.0 years ago by
Spain. Universidad de Córdoba
Antonio R. Franco4.3k wrote:
It is not only the path to the indexed genome. You need also to provide with the prefix name of that indexed genome
ADD COMMENTlink modified 4.0 years ago • written 4.0 years ago by Antonio R. Franco4.3k

When I am giving this simple command

bowtie2 -c e_coli GCGTGAGCTATGAGAAAGCGCCACGCTTCC

I am getting following error

(ERR): bowtie2-align exited with value. So there is something more that I am missing.

e_coli is prefix of index files and it is in the same directory.

ADD REPLYlink modified 17 months ago by RamRS25k • written 3.4 years ago by longevityamit0

Use this command instead

bowtie2 -x e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC
ADD REPLYlink written 3.4 years ago by genomax78k

Did not work. Now it is giving new problem:

bowtie2 -x e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC

Could not locate a Bowtie index corresponding to basename "e_coli" Error: Encountered internal Bowtie 2 exception (#1) Command: /home/amit/bin/bowtie2-align-s --wrapper basic-0 -x e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC (ERR): bowtie2-align exited with value 1

To cross check whether my directory contains e_coli prefix indexes

cat e_coli.

e_coli.1.ebwt e_coli.2.ebwt e_coli.3.ebwt e_coli.4.ebwt e_coli.rev.1.ebwt e_coli.rev.2.ebwt

  1. This did not resolve the problem of (ERR): bowtie2-align exited with value 1
  2. Usage of this brings new more error.
ADD REPLYlink modified 3.4 years ago • written 3.4 years ago by longevityamit0

Since your local directory is not in your $PATH you need to specify

bowtie2 -x ./e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC

If you are not in the directory where the index files are then do (replace path_to with a real file path on your system)

bowtie2 -x /path_to/e_coli -c GCGTGAGCTATGAGAAAGCGCCACGCTTCC
ADD REPLYlink modified 3.4 years ago • written 3.4 years ago by genomax78k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 826 users visited in the last hour