Question: compare 2 sequence using blast from different identification files
1
gravatar for kws15
3.1 years ago by
kws1540
kws1540 wrote:

Hi everyone

i am trying to compare promoters sequence of two species using blast2seq , so i have a table generated from the genome genbank file using python and the table,which is a txt file, looks like something this , each GeneID has a corresponding XP value and other information.

LOC101251020 XP_004228330.1 GeneID:101251020 NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 6


LOC101251313 XP_004228331.1 GeneID:101251313 F-box/kelch-repeat protein At1g55270-like

LOC101251313 XP_010314935.1 GeneID:101251313 F-box/kelch-repeat protein At1g55270-like

LOC101251313 XP_010315084.1 GeneID:101251313 F-box/kelch-repeat protein At1g55270-li

LOC101264245 XP_004228763.1 GeneID:101264245 NAC domain-containing protein 78-like

LOC101264547 XP_004228764.1 GeneID:101264547 uncharacterized protein LOC101264547

LOC104645410 XP_010315223.1 GeneID:104645410 probable E3 ubiquitin protein ligase DRIPH


what i am interested in there are the GeneID and XP_value, becuase the promoter is labelled by GeneID like this

Promoter___GeneID:101251020___43560:50059 TTATGATGGGTGACCCCCTCCGAAGTCCTTGTGTTGCATCCCTCCTTTTTTTCAAAATCGGTCGTGTAATTGAAAAATATTTTTATTTATTTATTTTTGCAGATACGACGTTC


also i have another text file table showing the match pairs of sequences , what i want is getting the corresponding promoters identification ID (GeneID) of these sequence through table one and the promoter sequence through the promoter files, so that i can use blast to compare their promoters, does anyone know how i can do this automatically for a lot of sequences? thank you very much

1 3517 S.lyco.fasta 1.000 XP_004228331.1 100%

1 3517 spen.fasta 1.000 XP_004228763.1 100%

2 3145 S.lyco.fasta 1.000 XP_004236763.1 100%

2 3145 spen.fasta 1.000 XP_004228763.1 100%

3 3078 S.lyco.fasta 1.000 XP_008522763.1 100%

3 3078 spen.fasta 1.000 XP_000753763.1 100%

blast genbank promoters • 812 views
ADD COMMENTlink modified 3.1 years ago • written 3.1 years ago by kws1540
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1049 users visited in the last hour