BSP Primers Alignment Option Optimization (Bismark)
0
0
Entering edit mode
5.6 years ago
Shicheng Guo ★ 8.8k

Here, suppose I have lots of BSP primers, I want to know where these primers were located?

Therefore, I try to assemble them to fa and then transfer to fastq and then align them to human hg19 genome.

However, You can image, only few of them can be aligned since reads too short?

Any suggestion, how to align BSP primers to human hg19 genome?

my alignment command:

step 1:

bismark --non_directional ~/oasis/db/hg19/meth/bismark/ primer.fastq

step 2:

bismark --non_directional ~/oasis/db/hg19/meth/bismark/ primer.fastq -1 primer1.fastq -2 primer2.fastq

only 4 primers were successfully mapped to hg19

MBP3R   0       chr18   74692190        42      24M     *       0       0       TTATGTTTTTATTTAATTGTTGGT        IIIIIIIIIIIIIIIIIIIIIIII        NM:i:5  MD:Z:1C5C1C6C6C0        XM:Z:.h.....h.h......x......x   XR:Z:GA XG:Z:CT
Brain1L 16      chr4    104106668       42      24M     *       0       0       TTATTTTAAAGATTTGGGTAGTTT        IIIIIIIIIIIIIIIIIIIIIIII        NM:i:7  MD:Z:7G2A0G3A0A0A1G4    XM:Z:.......h...h.......hH...   XR:Z:GA XG:Z:GA
REG1AL  0       chr2    79347449        42      25M     *       0       0       AGTTGTGATTATTTTTAGTGTGTGT       IIIIIIIIIIIIIIIIIIIIIIIII       NM:i:7  MD:Z:8C0C1C1C0C0C8C0    XM:Z:........hh.h.hhx........x  XR:Z:CT XG:Z:CT
CUX2R   16      chr2    82200171        42      25M     *       0       0       TTTAATAATAATTAGTTTGTGTGGA       IIIIIIIIIIIIIIIIIIIIIIIII       NM:i:4  MD:Z:3G10A8A0G0 XM:Z:...h..............H.H.H.h  XR:Z:CT XG:Z:GA

The fastq file were as the following:

@INSL
TTTTGGGGATTTGATTTAGT
+
IIIIIIIIIIIIIIIIIIII
@INSR
ACTCACCCTACAAATCCTCTAC
+
IIIIIIIIIIIIIIIIIIIIII
@MBP3L
GTGTATTTGGTTTTTTGAAGATT
+
IIIIIIIIIIIIIIIIIIIIIII
@MBP3R
ACCAACAATTAAATAAAAACATAA
+
IIIIIIIIIIIIIIIIIIIIIIII
@WM1L
GTTGGATGTGTTTGGTATATTAA
+
IIIIIIIIIIIIIIIIIIIIIII
@WM1R
AAAAACCAATAATAACCTTAAAA
+
IIIIIIIIIIIIIIIIIIIIIII
@Brain1L
TTATTTTAAAGATTTGGGTAGTTT
+
IIIIIIIIIIIIIIIIIIIIIIII
@Brain1R
AAATCCTTTACAACTCCCTAAC
+
IIIIIIIIIIIIIIIIIIIIII
@REG1AL
AGTTGTGATTATTTTTAGTGTGTGT
+
IIIIIIIIIIIIIIIIIIIIIIIII
@REG1AR
ATATCAAAATCTAAAATAAAAACCA
+
IIIIIIIIIIIIIIIIIIIIIIIII
@CUX2L
TTTGTAGAGGAATGGGTTGG
+
IIIIIIIIIIIIIIIIIIII
@CUX2R
TCCACACAAACTAATTATTATTAAA
+
IIIIIIIIIIIIIIIIIIIIIIIII
  
BSP Primer Alignment • 1.5k views
ADD COMMENT
1
Entering edit mode

Hi - did you ever figure out how to get Bismark to recognize all primers? I am getting the same result with the same set of primers from Lehmann-Werman 2016. Thanks

ADD REPLY
0
Entering edit mode

Yes. Ask the authors where the primers located and then apply bismark to align these primer to these small regions.

ADD REPLY

Login before adding your answer.

Traffic: 2702 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6