Question: paired reads adaptor trimming
0
gravatar for prostoesh
2.2 years ago by
prostoesh10
Russian Federation
prostoesh10 wrote:

Hi! i have 2 files with paied reads (forward and reversed) and i'm wanting to trimm adapters from these reads.

the problem is in fastqc tool - i'm seeing in its output, that forward reads have problems on both adapter content and overrepresented sequences (which provides me an actual secuence of adapter). Thr adaptor here is GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGC

but on the reversed reads, fastqc says that there are adapters (at the end of reads) but no overrepresented sequences, hence i don't have a sequence to trimm.

is there a way to define this reversed adapter?

assembly genome • 976 views
ADD COMMENTlink modified 2.2 years ago by Govardhan Anande130 • written 2.2 years ago by prostoesh10
2
gravatar for Govardhan Anande
2.2 years ago by
Australia
Govardhan Anande130 wrote:

You can get all adapters from here

ADD COMMENTlink written 2.2 years ago by Govardhan Anande130
0
gravatar for Govardhan Anande
2.2 years ago by
Australia
Govardhan Anande130 wrote:

if it is illumina sequencing then I think you might have any of the following adapters:

Adaptor1_5p GATCGGAAGAGCACACGTCTGAACTC Adaptor2_5p AGATCGGAAGAGCGTCGTGTAGGGAA Adaptor3_5p TTCCCTACACGACGCTCTTCCGATCT Adaptor4_5p GAGTTCAGACGTGTGCTCTTCCGATC Adaptor1_3p TTCCCTACACGACGCTCTTCCGATCT Adaptor2_3p GAGTTCAGACGTGTGCTCTTCCGATC Adaptor3_3p GATCGGAAGAGCACACGTCTGAACTC Adaptor4_3p AGATCGGAAGAGCGTCGTGTAGGGAA TruSeq-Universal_Adapter_5p AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT TruSeq-Universal_Adapter_3p TCTAGCCTTCTCGCAGCACATCCCTTTCTCACATCTAGAGCCACCAGCGGCATAGTAA

ADD COMMENTlink modified 2.2 years ago • written 2.2 years ago by Govardhan Anande130

yes, there are like libraries, but it seems unreasonable to test all of them - there must a way to tell what adapter fastqc is showing, or which is paired to the one i've found in forward reads

ADD REPLYlink written 2.2 years ago by prostoesh10
1

You don't have to test them one by one, just put it like :

python2.7 cutadapt-1.8.1/bin/cutadapt -a GATCGGAAGAGCACACGTCTGAACTC -A GAGTTCAGACGTGTGCTCTTCCGATC -a AGATCGGAAGAGCGTCGTGTAGGGAA -A TTCCCTACACGACGCTCTTCCGATCT -a TTCCCTACACGACGCTCTTCCGATCT -A AGATCGGAAGAGCGTCGTGTAGGGAA -a GAGTTCAGACGTGTGCTCTTCCGATC -A GATCGGAAGAGCACACGTCTGAACTC -b GATCGGAAGAGCACACGTCTGAACTC -B GAGTTCAGACGTGTGCTCTTCCGATC -b AGATCGGAAGAGCGTCGTGTAGGGAA -B TTCCCTACACGACGCTCTTCCGATCT -b TTCCCTACACGACGCTCTTCCGATCT -B AGATCGGAAGAGCGTCGTGTAGGGAA -b GAGTTCAGACGTGTGCTCTTCCGATC -B GATCGGAAGAGCACACGTCTGAACTC -m 30 -o out_R1.fastq -p out_R2.fastq input_R1.fastq input_R2.fastq
ADD REPLYlink modified 2.2 years ago • written 2.2 years ago by Govardhan Anande130

wow, thanks a lot for a whole command! i'm doing this now

can you also give me link for a source for these sequnces? i wounder what other adapters are there

ADD REPLYlink modified 2.2 years ago • written 2.2 years ago by prostoesh10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 944 users visited in the last hour