Question: save data from R console
0
gravatar for kapil.joshi036
3.2 years ago by
Student ,School of life sciences, Manipal University, Manipal, India
kapil.joshi03680 wrote:

Hello, I am going through the Bioconductor package called SangerseqR . in which intermediately some data get produced which comes into console . is it possible to save that into a text file I wanna to solate the data from $PCON.1 & $PCON.2

   $PBAS.1
[1] "GTAATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAATTCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTCTGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAAGCCCCTTCGCACATTTTTTCTTTTTTTA"

$PBAS.2
[1] "GTAATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAATTCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTCTGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAAGCCCCTTCGCACATTTTTTCTTTTTTTAG"

$PCON.1
  [1]  5  4  3  5  4  4  5  5 25 19  7  9 16 23 10 18 16 12 27 18 13 23 22 40 17 18 35
 [28] 33 40 50 28 37 28 52 25 14 28 50 42 50 35 25 52 54 49 29 29 28 41 30 54 29 24 14
 [55] 33 22 46 45 33 31 32 62 46 20 27 21 38 27 12 10 10 11 13  9 14 16 14 34 24 22 27
 [82] 22 30 27 51 22 22 35 26 38 35 59 59 59 39 51 45 44 39 35 62 44 44 34 34 30 24 18
[109] 39 50 34 26 24 27 28 30 50 30 34 34 23 24 17 43 51 43 56 51 43 38 38 32 51 62 59
[136] 30 44 24 28 23 30 34 39 43 34 45 43 45 59 51 34 43 39 34 51 59 43 44 43 45 50 43
[163] 56 59 56 56 51 45 51 51 43 43 51 43 51 62 46 39 34 43 51 43 39 34 50 45 41 62 43
[190] 50 50 59 51 50 56 59 56 34 45 56 43 43 45 51 47 59 50 45 51 51 62 45 51 59 51 45
[217] 62 62 62 51 62 59 62 59 56 39 34 24 18 43 39 44 39 37 38 43 51 51 43 51 45 51 59
[244] 43 59 41 59 45 51 51 51 51 51 51 45 59 51 51 56 59 51 51 59 51 43 59 59 62 51 56
[271] 59 51 51 51 56 56 59 39 39 45 43 34 56 59 45 51 56 51 56 56 56 56 51 38 42 51 42
[298] 42 62 38 62 50 51 51 51 56 56 51 42 25 42 30 31 27 51 42 51 39 42 56 56 51 38 38
[325] 38 31 37 38 51 56 56 56 56 56 56 56 62 51 42 56 51 56 42 51 56 51 62 56 62 51 45
[352] 50 38 50 56 56 38 51 56 56 56 42 56 51 56 50 56 56 51 51 56 50 56 56 56 51 56 51
[379] 38 56 51 56 46 56 50 56 56 56 56 62 62 62 62 56 56 51 56 56 38 38 39 15 42 56 56
[406] 56 56 56 56 62 62 56 56 56 56 56 56 56 56 51 39 51 56 56 56 51 62 56 51 56 56 56
[433] 30 56 62 62 62 56 56 56 62 56 50 56 56 54 56 56 56 56 56 56 31 56 56 62 39 62 56
[460] 56 62 38 56 62 56 62 47 62 62 50 43 56 62 56 50 56 56 41 54 43 43 47 27 62 56 62
[487] 62 62 62 62 62 62 62 56 33 62 52 62 62 62 40 62 62 54 62 62 52 62 62 62 62 62 54
[514] 54 52 62 54 51 62 62 62 43 62 62 62 62 62 62 62 62 52 62 62 42 54 62 54 62 52 62
[541] 52 43 54 62 62 62 62 54 50 58 58 54 58 52 46 52 52 42 40 52 58 58 58 52 54 45 26
[568] 52 52 48 18 43 54 52 52 52 52 52 52 42 52 58 58 52 58 58 58 58 54 58 54 35 54 52
[595] 40 41 54 45 42 52 52 54 25 58 42 54 54 39 47 47 52 46 46 45 32 54 58 58 54 48 58
[622] 49 41 58 52 53 50 52 46 34 42 26 46 51 40 50 50 48 47 54 51 47 28 37 30 50 54 49
[649] 52 51 54 48 58 48 51 46 52 58 54 34 58 51 39 51 54 58 40 58 39 39 39 50 52 49 41
[676] 13 47 39 49 41 27 50 53 51 40 51 53 53 41 25 52 50 50 52 49 35 50 39 35 58 32 49
[703] 24 40 49 50 41 43 50 51 38 12 50 49 50 44 41 53 53 40 51 34 50 54 58 58 52 51 30
[730] 58 26  6 58 51 39 58 41 53 58 51 43 58 41 34 49 51 35 50 51 52 53 50 23 32 44 47
[757] 49 53 24 29 15 18 13  9  5 13 21  7 52 31 23 38 39 26 42 25  4  7 20 51 54 51 23
[784] 23 32 18  9  4  5  4  8 11 16 16  6  9  9 11 11 11  5  5  6  5  5

$PCON.2
  [1]  5  4  3  5  4  4  5  5 25 19  7  9 16 23 10 18 16 12 27 18 13 23 22 40 17 18 35
 [28] 33 40 50 28 37 28 52 25 14 28 50 42 50 35 25 52 54 49 29 29 28 41 30 54 29 24 14
 [55] 33 22 46 45 33 31 32 62 46 20 27 21 38 27 12 10 10 11 13  9 14 16 14 34 24 22 27
 [82] 22 30 27 51 22 22 35 26 38 35 59 59 59 39 51 45 44 39 35 62 44 44 34 34 30 24 18
[109] 39 50 34 26 24 27 28 30 50 30 34 34 23 24 17 43 51 43 56 51 43 38 38 32 51 62 59
[136] 30 44 24 28 23 30 34 39 43 34 45 43 45 59 51 34 43 39 34 51 59 43 44 43 45 50 43
[163] 56 59 56 56 51 45 51 51 43 43 51 43 51 62 46 39 34 43 51 43 39 34 50 45 41 62 43
[190] 50 50 59 51 50 56 59 56 34 45 56 43 43 45 51 47 59 50 45 51 51 62 45 51 59 51 45
[217] 62 62 62 51 62 59 62 59 56 39 34 24 18 43 39 44 39 37 38 43 51 51 43 51 45 51 59
[244] 43 59 41 59 45 51 51 51 51 51 51 45 59 51 51 56 59 51 51 59 51 43 59 59 62 51 56
[271] 59 51 51 51 56 56 59 39 39 45 43 34 56 59 45 51 56 51 56 56 56 56 51 38 42 51 42
[298] 42 62 38 62 50 51 51 51 56 56 51 42 25 42 30 31 27 51 42 51 39 42 56 56 51 38 38
[325] 38 31 37 38 51 56 56 56 56 56 56 56 62 51 42 56 51 56 42 51 56 51 62 56 62 51 45
[352] 50 38 50 56 56 38 51 56 56 56 42 56 51 56 50 56 56 51 51 56 50 56 56 56 51 56 51
[379] 38 56 51 56 46 56 50 56 56 56 56 62 62 62 62 56 56 51 56 56 38 38 39 15 42 56 56
[406] 56 56 56 56 62 62 56 56 56 56 56 56 56 56 51 39 51 56 56 56 51 62 56 51 56 56 56
[433] 30 56 62 62 62 56 56 56 62 56 50 56 56 54 56 56 56 56 56 56 31 56 56 62 39 62 56
[460] 56 62 38 56 62 56 62 47 62 62 50 43 56 62 56 50 56 56 41 54 43 43 47 27 62 56 62
[487] 62 62 62 62 62 62 62 56 33 62 52 62 62 62 40 62 62 54 62 62 52 62 62 62 62 62 54
[514] 54 52 62 54 51 62 62 62 43 62 62 62 62 62 62 62 62 52 62 62 42 54 62 54 62 52 62
[541] 52 43 54 62 62 62 62 54 50 58 58 54 58 52 46 52 52 42 40 52 58 58 58 52 54 45 26
[568] 52 52 48 18 43 54 52 52 52 52 52 52 42 52 58 58 52 58 58 58 58 54 58 54 35 54 52
[595] 40 41 54 45 42 52 52 54 25 58 42 54 54 39 47 47 52 46 46 45 32 54 58 58 54 48 58
[622] 49 41 58 52 53 50 52 46 34 42 26 46 51 40 50 50 48 47 54 51 47 28 37 30 50 54 49
[649] 52 51 54 48 58 48 51 46 52 58 54 34 58 51 39 51 54 58 40 58 39 39 39 50 52 49 41
[676] 13 47 39 49 41 27 50 53 51 40 51 53 53 41 25 52 50 50 52 49 35 50 39 35 58 32 49
[703] 24 40 49 50 41 43 50 51 38 12 50 49 50 44 41 53 53 40 51 34 50 54 58 58 52 51 30
[730] 58 26  6 58 51 39 58 41 53 58 51 43 58 41 34 49 51 35 50 51 52 53 50 23 32 44 47
[757] 49 53 24 29 15 18 13  9  5 13 21  7 52 31 23 38 39 26 42 25  4  7 20 51 54 51 23
[784] 23 32 18  9  4  5  4  8 11 16 16  6  9  9 11 11 11  5  5  6  5  5
sequencing R genome • 1.3k views
ADD COMMENTlink modified 3.2 years ago by Michael Dondrup46k • written 3.2 years ago by kapil.joshi03680

Hello kapil.joshi036!

We believe that this post does not fit the main topic of this site.

Not directly related to bioinformatics.

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

ADD REPLYlink written 3.2 years ago by genomax69k

OP is a new user. The package is for Sanger sequence data analyses, I would say it is bioinformatics and OP could be a newbie in R.

ADD REPLYlink written 3.2 years ago by Khader Shameer18k

There is one answer below that should work for the question that was asked.
If you think better answers than that will follow then I can open the question back up or you can as well.

ADD REPLYlink written 3.2 years ago by genomax69k

actually m working on heterozygous peak values in sangerseqR u get the details n m making it automated so that i wannt to extract that data from the console

ADD REPLYlink written 3.2 years ago by kapil.joshi03680
0
gravatar for Irsan
3.2 years ago by
Irsan6.9k
Amsterdam
Irsan6.9k wrote:

see documentation for write.table or write.csv, not really a bioinformationcs related question...

ADD COMMENTlink modified 3.2 years ago • written 3.2 years ago by Irsan6.9k
0
gravatar for Deepak Tanwar
3.2 years ago by
Deepak Tanwar4.0k
ETH Zürich, Switzerland
Deepak Tanwar4.0k wrote:

You could either save the data with write commands in R or you could print it out through a R script and redirect it to a file. Like: Rscript test.R > data.txt

ADD COMMENTlink written 3.2 years ago by Deepak Tanwar4.0k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 630 users visited in the last hour