save data from R console
2
0
Entering edit mode
6.1 years ago

Hello, I am going through the Bioconductor package called SangerseqR . in which intermediately some data get produced which comes into console . is it possible to save that into a text file I wanna to solate the data from $PCON.1 & $PCON.2

   $PBAS.1
[1] "GTAATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAATTCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTCTGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAAGCCCCTTCGCACATTTTTTCTTTTTTTA"

$PBAS.2
[1] "GTAATCTCAACTTAGTATTATACCCACACCCACCCAAGAACAGGGTTTGTTAAGATGGCAGAGCCCGGTAATCGCATAAAACTTAAAACTTTACAGTCAGAGGTTCAATTCCTCTTCTTAACAACATACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAATCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATACAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACCCTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCACATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATCGCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCTCAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACTCAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGCGCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCATCATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCCTTATCACAACACAAGAACACCTCTGATTACTCCTGCCATCATGACCCTTGGCCATAATATGATTTATCTCCACACTAGCAGAGACCAACCGAACCCCCTTCGACCTTGCCGAAGGGGAGTCTGAACTAGTCTCAGGCTTCAACATCGAATACGCCGCAAGCCCCTTCGCACATTTTTTCTTTTTTTAG"

$PCON.1
  [1]  5  4  3  5  4  4  5  5 25 19  7  9 16 23 10 18 16 12 27 18 13 23 22 40 17 18 35
 [28] 33 40 50 28 37 28 52 25 14 28 50 42 50 35 25 52 54 49 29 29 28 41 30 54 29 24 14
 [55] 33 22 46 45 33 31 32 62 46 20 27 21 38 27 12 10 10 11 13  9 14 16 14 34 24 22 27
 [82] 22 30 27 51 22 22 35 26 38 35 59 59 59 39 51 45 44 39 35 62 44 44 34 34 30 24 18
[109] 39 50 34 26 24 27 28 30 50 30 34 34 23 24 17 43 51 43 56 51 43 38 38 32 51 62 59
[136] 30 44 24 28 23 30 34 39 43 34 45 43 45 59 51 34 43 39 34 51 59 43 44 43 45 50 43
[163] 56 59 56 56 51 45 51 51 43 43 51 43 51 62 46 39 34 43 51 43 39 34 50 45 41 62 43
[190] 50 50 59 51 50 56 59 56 34 45 56 43 43 45 51 47 59 50 45 51 51 62 45 51 59 51 45
[217] 62 62 62 51 62 59 62 59 56 39 34 24 18 43 39 44 39 37 38 43 51 51 43 51 45 51 59
[244] 43 59 41 59 45 51 51 51 51 51 51 45 59 51 51 56 59 51 51 59 51 43 59 59 62 51 56
[271] 59 51 51 51 56 56 59 39 39 45 43 34 56 59 45 51 56 51 56 56 56 56 51 38 42 51 42
[298] 42 62 38 62 50 51 51 51 56 56 51 42 25 42 30 31 27 51 42 51 39 42 56 56 51 38 38
[325] 38 31 37 38 51 56 56 56 56 56 56 56 62 51 42 56 51 56 42 51 56 51 62 56 62 51 45
[352] 50 38 50 56 56 38 51 56 56 56 42 56 51 56 50 56 56 51 51 56 50 56 56 56 51 56 51
[379] 38 56 51 56 46 56 50 56 56 56 56 62 62 62 62 56 56 51 56 56 38 38 39 15 42 56 56
[406] 56 56 56 56 62 62 56 56 56 56 56 56 56 56 51 39 51 56 56 56 51 62 56 51 56 56 56
[433] 30 56 62 62 62 56 56 56 62 56 50 56 56 54 56 56 56 56 56 56 31 56 56 62 39 62 56
[460] 56 62 38 56 62 56 62 47 62 62 50 43 56 62 56 50 56 56 41 54 43 43 47 27 62 56 62
[487] 62 62 62 62 62 62 62 56 33 62 52 62 62 62 40 62 62 54 62 62 52 62 62 62 62 62 54
[514] 54 52 62 54 51 62 62 62 43 62 62 62 62 62 62 62 62 52 62 62 42 54 62 54 62 52 62
[541] 52 43 54 62 62 62 62 54 50 58 58 54 58 52 46 52 52 42 40 52 58 58 58 52 54 45 26
[568] 52 52 48 18 43 54 52 52 52 52 52 52 42 52 58 58 52 58 58 58 58 54 58 54 35 54 52
[595] 40 41 54 45 42 52 52 54 25 58 42 54 54 39 47 47 52 46 46 45 32 54 58 58 54 48 58
[622] 49 41 58 52 53 50 52 46 34 42 26 46 51 40 50 50 48 47 54 51 47 28 37 30 50 54 49
[649] 52 51 54 48 58 48 51 46 52 58 54 34 58 51 39 51 54 58 40 58 39 39 39 50 52 49 41
[676] 13 47 39 49 41 27 50 53 51 40 51 53 53 41 25 52 50 50 52 49 35 50 39 35 58 32 49
[703] 24 40 49 50 41 43 50 51 38 12 50 49 50 44 41 53 53 40 51 34 50 54 58 58 52 51 30
[730] 58 26  6 58 51 39 58 41 53 58 51 43 58 41 34 49 51 35 50 51 52 53 50 23 32 44 47
[757] 49 53 24 29 15 18 13  9  5 13 21  7 52 31 23 38 39 26 42 25  4  7 20 51 54 51 23
[784] 23 32 18  9  4  5  4  8 11 16 16  6  9  9 11 11 11  5  5  6  5  5

$PCON.2
  [1]  5  4  3  5  4  4  5  5 25 19  7  9 16 23 10 18 16 12 27 18 13 23 22 40 17 18 35
 [28] 33 40 50 28 37 28 52 25 14 28 50 42 50 35 25 52 54 49 29 29 28 41 30 54 29 24 14
 [55] 33 22 46 45 33 31 32 62 46 20 27 21 38 27 12 10 10 11 13  9 14 16 14 34 24 22 27
 [82] 22 30 27 51 22 22 35 26 38 35 59 59 59 39 51 45 44 39 35 62 44 44 34 34 30 24 18
[109] 39 50 34 26 24 27 28 30 50 30 34 34 23 24 17 43 51 43 56 51 43 38 38 32 51 62 59
[136] 30 44 24 28 23 30 34 39 43 34 45 43 45 59 51 34 43 39 34 51 59 43 44 43 45 50 43
[163] 56 59 56 56 51 45 51 51 43 43 51 43 51 62 46 39 34 43 51 43 39 34 50 45 41 62 43
[190] 50 50 59 51 50 56 59 56 34 45 56 43 43 45 51 47 59 50 45 51 51 62 45 51 59 51 45
[217] 62 62 62 51 62 59 62 59 56 39 34 24 18 43 39 44 39 37 38 43 51 51 43 51 45 51 59
[244] 43 59 41 59 45 51 51 51 51 51 51 45 59 51 51 56 59 51 51 59 51 43 59 59 62 51 56
[271] 59 51 51 51 56 56 59 39 39 45 43 34 56 59 45 51 56 51 56 56 56 56 51 38 42 51 42
[298] 42 62 38 62 50 51 51 51 56 56 51 42 25 42 30 31 27 51 42 51 39 42 56 56 51 38 38
[325] 38 31 37 38 51 56 56 56 56 56 56 56 62 51 42 56 51 56 42 51 56 51 62 56 62 51 45
[352] 50 38 50 56 56 38 51 56 56 56 42 56 51 56 50 56 56 51 51 56 50 56 56 56 51 56 51
[379] 38 56 51 56 46 56 50 56 56 56 56 62 62 62 62 56 56 51 56 56 38 38 39 15 42 56 56
[406] 56 56 56 56 62 62 56 56 56 56 56 56 56 56 51 39 51 56 56 56 51 62 56 51 56 56 56
[433] 30 56 62 62 62 56 56 56 62 56 50 56 56 54 56 56 56 56 56 56 31 56 56 62 39 62 56
[460] 56 62 38 56 62 56 62 47 62 62 50 43 56 62 56 50 56 56 41 54 43 43 47 27 62 56 62
[487] 62 62 62 62 62 62 62 56 33 62 52 62 62 62 40 62 62 54 62 62 52 62 62 62 62 62 54
[514] 54 52 62 54 51 62 62 62 43 62 62 62 62 62 62 62 62 52 62 62 42 54 62 54 62 52 62
[541] 52 43 54 62 62 62 62 54 50 58 58 54 58 52 46 52 52 42 40 52 58 58 58 52 54 45 26
[568] 52 52 48 18 43 54 52 52 52 52 52 52 42 52 58 58 52 58 58 58 58 54 58 54 35 54 52
[595] 40 41 54 45 42 52 52 54 25 58 42 54 54 39 47 47 52 46 46 45 32 54 58 58 54 48 58
[622] 49 41 58 52 53 50 52 46 34 42 26 46 51 40 50 50 48 47 54 51 47 28 37 30 50 54 49
[649] 52 51 54 48 58 48 51 46 52 58 54 34 58 51 39 51 54 58 40 58 39 39 39 50 52 49 41
[676] 13 47 39 49 41 27 50 53 51 40 51 53 53 41 25 52 50 50 52 49 35 50 39 35 58 32 49
[703] 24 40 49 50 41 43 50 51 38 12 50 49 50 44 41 53 53 40 51 34 50 54 58 58 52 51 30
[730] 58 26  6 58 51 39 58 41 53 58 51 43 58 41 34 49 51 35 50 51 52 53 50 23 32 44 47
[757] 49 53 24 29 15 18 13  9  5 13 21  7 52 31 23 38 39 26 42 25  4  7 20 51 54 51 23
[784] 23 32 18  9  4  5  4  8 11 16 16  6  9  9 11 11 11  5  5  6  5  5
genome R sequencing • 2.0k views
ADD COMMENT
0
Entering edit mode

Hello kapil.joshi036!

We believe that this post does not fit the main topic of this site.

Not directly related to bioinformatics.

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

ADD REPLY
0
Entering edit mode

OP is a new user. The package is for Sanger sequence data analyses, I would say it is bioinformatics and OP could be a newbie in R.

ADD REPLY
0
Entering edit mode

There is one answer below that should work for the question that was asked.
If you think better answers than that will follow then I can open the question back up or you can as well.

ADD REPLY
0
Entering edit mode

actually m working on heterozygous peak values in sangerseqR u get the details n m making it automated so that i wannt to extract that data from the console

ADD REPLY
0
Entering edit mode
6.1 years ago
Irsan ★ 7.5k

see documentation for write.table or write.csv, not really a bioinformationcs related question...

ADD COMMENT
0
Entering edit mode
6.1 years ago
Deepak Tanwar ★ 4.2k

You could either save the data with write commands in R or you could print it out through a R script and redirect it to a file. Like: Rscript test.R > data.txt

ADD COMMENT

Login before adding your answer.

Traffic: 1971 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6