Get Number Of Mismatches In Pysam Colourspace Aligment
0
0
Entering edit mode
9.6 years ago
User 8663 • 0

hello I have an alignment done in colourspace, in the SAM format, and one of the statistics that I need to get out is length of aligned read and the number of mismatches. While the length of aligned read is easy, I don't have the tag "NM", only the "CM". I use pysam to parse the files. The problem is that, when I received the alignment, I also received a statistic file here the maximum number of mismatches are 10, but if I use the "CM" tag I get 11. Also, if I compare the sequence i get with read.seq with the one in the reference assembly, i don't get "CM" number of mismatches.

thanks in advance

solid • 2.5k views
ADD COMMENT
0
Entering edit mode

can you post an example? the number of colorspace mismatches (CM) is not the same as the number of base-space mismatches (comparing sequence with read.seq)

ADD REPLY
0
Entering edit mode

Of course, i got a quick one CM = 1 seq = AGAACAAAGTGCCTGTGTACCTAAGAAAGTTCCTGTCTCTCTAAGAGTCA pos = mouse chr 6:41071878 reverse 50bp the sequence in ensemble is equal!!

ADD REPLY

Login before adding your answer.

Traffic: 1759 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6