Question: [NCBI BLAST] MAKE Limitation of BLAST Results.
1
gravatar for clear.choi
3.3 years ago by
clear.choi30
United States
clear.choi30 wrote:

Hello,

I am using blast version ncbi-blast-2.2.29+.

I wonder how I can make limitation of alignment information per allele

For Example as below,

If blast search results like below,

> AI4E8.UA
Length=130

Score = 99.0 bits (53),  Expect = 2e-22
Identities = 53/53 (100%), Gaps = 0/53 (0%)
Strand=Plus/Plus

Query  3012  AGGCAAGATTTGTTCCTGCCCTTCTACGATGTGATGCTTGCACAAGTGATCCA  3064
             |||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct  78    AGGCAAGATTTGTTCCTGCCCTTCTACGATGTGATGCTTGCACAAGTGATCCA  130

Score = 56.5 bits (30),  Expect = 1e-09
Identities = 30/30 (100%), Gaps = 0/30 (0%)
Strand=Plus/Plus

Query  17  GCAGTCGAACATGTAGCTGACTCAGGTCAC  46
           ||||||||||||||||||||||||||||||
Sbjct  1   GCAGTCGAACATGTAGCTGACTCAGGTCAC  30

Score = 56 bits (30),  Expect = 1e-09
Identities = 29/29 (100%), Gaps = 0/30 (0%)
Strand=Plus/Plus

Query 1000  GCAGTCGAACATGTAGCTGACTCAGGTCA  1029
           |||||||||||||||||||||||||||||
Sbjct  45   GCAGTCGAACATGTAGCTGACTCAGGTCA  74

There are three information, However, I would like bring only top two score from above Allele > AI4E8.UA.

I found some parameter which is -num_alignments, -num_descriptions , -max_target_seqs But those are not directly related with that.

Is there any specific parameter for that? Thank you,

blast ncbi • 1.1k views
ADD COMMENTlink written 3.3 years ago by clear.choi30

However, I would like bring only top two score from above Allele > AI4E8.UA.

Could you clarify what it is you want to achieve? Not sure I understand you... Do you want the top two scores only or do you want the above mentioned output just excluding the third alignment?

ADD REPLYlink modified 3.3 years ago • written 3.3 years ago by Jenez520

@Jenez Sorry for confusing you, Yes It is! I would like to bring only two alignment information excluding the third alignment.

ADD REPLYlink written 3.3 years ago by clear.choi30

If you add the argument -num_alignments 2 that should restrict it to just 2 alignment results. That didn't work for you?

ADD REPLYlink written 3.3 years ago by jackfrost219970
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1644 users visited in the last hour