Entering edit mode
7.9 years ago
Bulbul Ahmed
▴
20
i have a text file with gene id (gene_id.txt eg. n0_g1_i1; n0_g1_i11; n0_g1_i17 and other lakhs of gene id are there in the gene_id file ) and a denovo assmebly file (Triniry.fasta)
>n0_g1_i1 len=86
TTATGAACATGCATTTTCCTGCTCCTGCTTTTTCTACTTAATACGTGAGTAGATAATAAATATCGGAAAAATATTTAAATAATAAT
>n1_g1_i1 len=85
GAGGGGGTTCCTTTACTTAAAACTACACTTGAAAATAATGATTATAACATACCGTCATTATTAAATATTAGCAAAAACCGTGAT
(it ih a header of the assmbled file). i need to extract all the sequencces from the assmbly file which are present in the gne_id.txt. how should i retrive the sequences from the assembly file using perl script???
