Adapter trimming in basespace
2
0
Entering edit mode
5.2 years ago
kanwarjag ★ 1.1k

I have used NuGEN RNA-seq kit and adapter sequence. is AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (TruSeq Universal Adapter) However in base space (FASTqToolkit) closest one is True seq dual HT/LT but it is not completely matching Another option is Ht/Lt common seq of 12 bases. What should be my best choice. In base space I cannot paste my adaptor seq.

PS: I have accidently posted the question in Galaxy, so reposting here.

general adapter • 2.3k views
ADD COMMENT
0
Entering edit mode

If the adapter is TruSeq universal that must surely be available for trimming (perhaps done by default) in BaseSpace?

ADD REPLY
0
Entering edit mode
5.2 years ago
agata88 ▴ 820

Try Trimmomatic. http://www.usadellab.org/cms/?page=trimmomatic

You can put your adapter sequence in fasta file as an input.

Best,

Agata

ADD COMMENT
0
Entering edit mode

Question from @kanwarjag is about options for BaseSpace so while this answer is generally good it is not applicable in this case.

ADD REPLY
0
Entering edit mode
5.2 years ago
kirannbishwa01 ★ 1.3k

1) You can also use bbmap https://sourceforge.net/projects/bbmap/ and the function bbmerge to find the adapter sequence for your data. The output file can be supplemented to BBduk function to remove the adapters.

2) You can use the supplemented Illumina adapters that comes with bbmap to remove if there are any other adapter contamination.

3) finally you need to check how you fastQC report changes after trimming. http://www.bioinformatics.babraham.ac.uk/projects/fastqc/

Thanks,

ADD COMMENT
0
Entering edit mode

Question from @kanwarjag is about options for BaseSpace so while this answer is generally good it is not applicable in this case.

ADD REPLY
0
Entering edit mode

I apologize for miscommunication. Thanks for suggestions. However i am clarifying base space options. If some one has used base space please share their thoughts on the issue..

ADD REPLY

Login before adding your answer.

Traffic: 1660 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6