Question: samtools tview symbols
1
gravatar for kelly.wang135
2.4 years ago by
Korea, Republic Of
kelly.wang13530 wrote:

Hi all,

I'm trying to view my aligned sequences using samtools tview option and have questions in interpreting the result.

First, what does the first line mean? I found that it is genome coordinates and believe that N=nucleotides and *=no Ns? What kinds of symbols can exist other than N or *?

And as I know of it, the second line means reference sequence and from the thrid it should appear as "dots" or "commas" is my data match with reference sequence. But all my data appear as ATGCatgc. What should I do to make mathing sequences as dots or commas? And does upper/lower cases are related to strands?

Thanks!

$samtools tview sample1.recalrealndup.bam ucsc.hg19.fasta -p chr6:132421907

     132421911     132421921     132421931 132421941 132421951 132421961 132421971 132421981 132421991 132422001
N**NNNNNN**NNNN**NNNNN***N*NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
C  AAAAAA  AAAA  AAAAA   G TTTTTATGTGCACTTAAATTTGGGGACAATTTTATGTATCTGTGTTAAGGATATGTTTA
C**AAAAAA**AAAA**AAAAAAATG*TTTTTTTGTGCAATTAAATTTGGGGACAATTTTTTTTATCTGTGTTAAGGATATTTTTA
c**AAAAAA**AAAA**AAAAA***G*ATTTTATGT  ACTTAAATTTGGGGACAATTTTATGTATCTGTGTTAAGGATATGTTTA
c**AAAAAA**AAAA**AAAAA***T*TTTTTTTTTGAAATTAAATTTGGGGAAAATTTTAT      gtgttaaggatatgttta
tview samtools • 1.6k views
ADD COMMENTlink modified 13 months ago by tjb0 • written 2.4 years ago by kelly.wang13530

Since this thread has resurfaced... Shameless plug: If you are interested in samtools tview maybe have a look also at ASCIIGenome

ADD REPLYlink written 13 months ago by dariober9.7k
0
gravatar for tjb
13 months ago by
tjb0
tjb0 wrote:

See the answer to Samtools Tview Problem

Summary of that answer: 2 inputs are needed to tview, the bam file and the reference file

The root cause could be that the second file was missing or damaged.

ADD COMMENTlink written 13 months ago by tjb0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1961 users visited in the last hour