Question: using mysql on ucsc table browser
0
gravatar for bioguy24
3.8 years ago by
bioguy24190
Chicago
bioguy24190 wrote:

Is there a way to query the usuc mysql database using a file and return the fasta sequence of each line in the file and get the same output as in the table browser? This is DNA, CDS exons, one fasta record per region with 10 bases 5' and 3', exons in upper case, everything else in lower case. Thank you :).

file

A2M

output

>hg19_refGene_NM_000014_0 range=chr12:9268350-9268455 5'pad=10 3'pad=10 strand=- repeatMasking=none
  tttctgcaacATGGGGAAGAACAAACTCCTTCATCCAAGTCTGGTTCTTC
  TCCTCTTGGTCCTCCTGCCCACAGACGCCTCAGTCTCTGGAAAACCgtga
  gttcca
>hg19_refGene_NM_000014_1 range=chr12:9265946-9266149 5'pad=10 3'pad=10 strand=- repeatMasking=none
tcattcccagGCAGTATATGGTTCTGGTCCCCTCCCTGCTCCACACTGAG
ACCACTGAGAAGGGCTGTGTCCTTCTGAGCTACCTGAATGAGACAGTGAC
TGTAAGTGCTTCCTTGGAGTCTGTCAGGGGAAACAGGAGCCTCTTCACTG
ACCTGGAGGCGGAGAATGACGTACTCCACTGTGTCGCCTTCGCTgtgagt
gtgg

Maybe:

mysql --user=genome --host=genome-mysql.cse.ucsc.edu -A -D hg37 -e 'select /home/user/file()'
ngs • 996 views
ADD COMMENTlink written 3.8 years ago by bioguy24190

using mysql only ? no

ADD REPLYlink written 3.8 years ago by Pierre Lindenbaum127k

What do you suggest? Thanks.

ADD REPLYlink written 3.8 years ago by bioguy24190
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1111 users visited in the last hour