Adapters SureSelect QXT

Question

[Folder40g]

Hi

I'm analysing some exome (SureSelectQXT). I've asked people that sent me the data about the adapters, which are supposed to be CTGTCTCTTGATCAC.

I've checked this adapter in the files and I saw that about 6% of the reads contain that sequence (bot R1 and R2) followed by some other sequence.

> R1:
GAATCCATAACAGAGAAGTCCAGCATTGCAACCATGACCAGCGTGGGCAAGTCCAGGACCACCACCGAGTCCAGTGCCTGTCTCTTGATCACATCTACG
CCTGCTGGGAGGCTGCTCGCGGGAACTCAGGGAGACTGGGGATGTGTCTCTTGATCACATCTACGCACAGCTCCACCGTAAGGCGAATCTCGTATGCCGT

> R2:
GAGCCGGCTGAGCAGGAAGCGGCCGCCGTCAGGTAAGCGGCTTCGGGGGCCCGCGGGCCTGTCTCTTGATCACAAGTCTCGACGTCAGCGCGATCTAGTG
GCACTTTGGGAGGCCAAGGTGGGCGGATCACGAGGTCCTGTCTCTTGATCACAAGTCTCGACGTCAGCGCGATCTAGTGTAGATCTCGGTGGTCGCCGTA

I have asked for the whole adapter so I can remove it from those sequences, but they have no idea. In the manual page of SureSelectQXT, the only info that appears is the CTGTCTCTTGATCAC as adapter trim.

I don't thinks is a big deal, but if I can I think it would be a good idea to remove those adapters from the reads. I guess this is part of the adapter but I have no information about this.

Any clue?