Question: Read fragments to trim
0
gravatar for v82masae
2.7 years ago by
v82masae120
v82masae120 wrote:

Hi everyone. So I have another doubt about processing reads for miRNA-seq.

In the parameters I've recieved from the lab doing the sequencing process, they specify this:

SR Primer:

5 ́AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTGGGA3 ́

Index Primers:

5 ́CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT3 ́

Also they specify a series of short index sequences for each sample, as follows:

ID               Index Sequence 
7005           ATCACG
7006           CGATGT
7007           TTAGGC
.
.
.

I don't know what specific protocol they used to make the libraries, but I assume that what specified in Index primers is what I should trimm from my reads, being them in the NNNN fragment included between both primers to trim. But, what do the Index Sequence refer to? And what about the Sequence Reference primer (SR primer)? I don't know if I should also include them in a list of sequences to trim or not...

Any help to put some light in this?

ADD COMMENTlink modified 2.7 years ago • written 2.7 years ago by v82masae120

I assume you received the data demultiplexed, i.e. files just containing one sample?

ADD REPLYlink written 2.7 years ago by WouterDeCoster37k

I just realized that the NNNN corresponds to each index sequence (barcode) used in each sample for multiplexed run. So I assume that I should associate the corresponding Index primer completed with the barcode, in order to trim it from each sample. But I don't know what to do with the SR primer though. Should I include this sequence to be trimmed too?

ADD REPLYlink written 2.7 years ago by v82masae120
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 800 users visited in the last hour