Question: RNA Seq - Tophat GFF errror
0
gravatar for niznet84
3.6 years ago by
niznet840
United States
niznet840 wrote:

Hi All,

I can't figure out the answer to this problem for the life of me.

[2016-09-20 12:12:38] Building transcriptome data files.. [2016-09-20 12:12:39] Building Bowtie index from NC_007793.fa [FAILED] Error: Couldn't build bowtie index with err = 1

This is the tophat error I am getting.

This is my reference fasta:

gi|87159884|ref|NC_007793.1| ACTACTGCTCAATTTTTTTACTTTTATCGATTAAAGATAGAAATACACGATGCGAGCAATCAAATTTCAT AACATCACCATGAGTTTGGTCCGAAGCATGAGTGTTTACAATGTTCGAACACCTTATACAGTTCTTATAC ATACTTTATAAATTATTTCCCAAACTGTTTTGATACACTCACTAACAGATACTCTATAGAAGGAAAAGTT ATCCACTTATGCACATTTATAGTTTTCAGAATTGTGGATAATTAGAAATTACACACAAAGTTATACTAT

This is my reference gff

  1. gi|87159884|ref|NC_007793.1| RefSeq Coding gene 544 1905 . + . name=dnaA;product="chromosomal replication initiation protein"

Tophat works fine when I just use the reference file but when I try to align with the GTF it errors out.

Thanks in advance.

ADD COMMENTlink modified 3.6 years ago • written 3.6 years ago by niznet840

Can you also provide your tophat commands, one without GTF that works and one with GTF that doesn't work?

ADD REPLYlink written 3.6 years ago by Satyajeet Khare1.5k
0
gravatar for niznet84
3.6 years ago by
niznet840
United States
niznet840 wrote:

Found the solution, ran tophat/htseqcount separately and changed 'Coding gene' -> exon, and set the htseq parameter --idattr=name.

ADD COMMENTlink written 3.6 years ago by niznet840
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 925 users visited in the last hour