RNA Seq - Tophat GFF errror
1
0
Entering edit mode
4.7 years ago
niznet84 • 0

Hi All,

I can't figure out the answer to this problem for the life of me.

[2016-09-20 12:12:38] Building transcriptome data files.. [2016-09-20 12:12:39] Building Bowtie index from NC_007793.fa [FAILED] Error: Couldn't build bowtie index with err = 1

This is the tophat error I am getting.

This is my reference fasta:

gi|87159884|ref|NC_007793.1| ACTACTGCTCAATTTTTTTACTTTTATCGATTAAAGATAGAAATACACGATGCGAGCAATCAAATTTCAT AACATCACCATGAGTTTGGTCCGAAGCATGAGTGTTTACAATGTTCGAACACCTTATACAGTTCTTATAC ATACTTTATAAATTATTTCCCAAACTGTTTTGATACACTCACTAACAGATACTCTATAGAAGGAAAAGTT ATCCACTTATGCACATTTATAGTTTTCAGAATTGTGGATAATTAGAAATTACACACAAAGTTATACTAT

This is my reference gff

  1. gi|87159884|ref|NC_007793.1| RefSeq Coding gene 544 1905 . + . name=dnaA;product="chromosomal replication initiation protein"

Tophat works fine when I just use the reference file but when I try to align with the GTF it errors out.

Thanks in advance.

RNA-Seq annotations staph aureus tophat • 1.3k views
ADD COMMENT
0
Entering edit mode

Can you also provide your tophat commands, one without GTF that works and one with GTF that doesn't work?

ADD REPLY
0
Entering edit mode
4.7 years ago
niznet84 • 0

Found the solution, ran tophat/htseqcount separately and changed 'Coding gene' -> exon, and set the htseq parameter --idattr=name.

ADD COMMENT

Login before adding your answer.

Traffic: 1330 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6