Question: fastqc quality leading reads are all same
0
gravatar for sacha
2.5 years ago by
sacha1.7k
France
sacha1.7k wrote:

I get 16sRNA sequencing from illumina MiSeq. I Run fastQC and I get the following quality plot. Why the first 6 position has the same quality. Is it the barcode not removed ?
And when I look into my fastq , the header specify a sequence : TAATGCGCCCTATCCT . is it the barcode too ? And why they are 17 nucleotides ?

@HWI-D00473:173:H3KJTBCXX:2:1101:11770:2101 1:N:0:TAATGCGCCCTATCCT
CCGTCAATTCATTTAAGTTTCATACTTGCGTACGTACTCCCCAGGCGGATTACTTATCGCGTTAGCTTGGGCGCTGAGGTTCGACCCCCAACACCTAGTAATCATCGTTTACGGCGTGGACTACCAGGGTATCTAATCCTGTTTGCTACCCACGCTTTCG
CGCTTTAGCGTCAGTATCTGTCCAGTAAGCTGGCTTCCCCATCGGCATTCCTACAAATACCTACGACTTTCACCTCTACCCTTGTAGTTCCGCTTACCTCTCCAGTACTCTAGTCATCCAGTTTCCAACGCAATACCGAGT

enter image description here

fastqc miseq fastq • 1.1k views
ADD COMMENTlink modified 2.5 years ago • written 2.5 years ago by sacha1.7k
3
TAATGCGCCCTATCCT

That is the barcode sequence. If this was a 2D Barcode then the two barcodes are concatenated and represented as a single string. e.g. TAATGCGC-CCTATCCT (those would be the two barcodes).

Initially illumina assigns a lower quality value for bases as the Q-scores are calibrated which is what you are seeing at the beginning of the read. That has nothing to do with the barcodes.

ADD REPLYlink modified 2.5 years ago • written 2.5 years ago by genomax63k

Thanks to make it more clear. So I don't need to trim the first 6 bases ?

ADD REPLYlink written 2.5 years ago by sacha1.7k

No you don't need to.

ADD REPLYlink written 2.5 years ago by genomax63k

Regarding the following plot, it seems the beginning of the reads has exactly the same content. CGTCAT. Is there any relation with the first 6 high quality first base?

First bases

ADD REPLYlink modified 2.5 years ago • written 2.5 years ago by sacha1.7k

Is this experiment using an internal barcode that appears at the beginning of the reads (possible based on the plot above or otherwise this may be due to bad experimental design) then you would see something like this. This barcode can then be used for demultiplex the reads further.

ADD REPLYlink modified 2.5 years ago • written 2.5 years ago by genomax63k

See Here

ADD REPLYlink written 2.5 years ago by andrew.j.skelton735.5k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1756 users visited in the last hour