Question: intarprat blastn result
0
gravatar for nasromer2191989
4.1 years ago by
nasromer219198920 wrote:

I get this sequence from blastn searching for similarity how can I get the name of the gene ?

gb|BZ606208.1|BZ606208 WHACE55TF Human MCF7 breast cancer cell line library (MCF7_1) Homo sapiens genomic clone MCF7_1-14I13, genomic survey sequence ACTGCTAACGAATGCTCTGACTTTATTGCACTACTGTACTTTACAGCTAGCAGTGCAATAGTATTGTCAAAGCATCTGAAAGCAGG

blast • 898 views
ADD COMMENTlink modified 4.1 years ago by Pierre Lindenbaum131k • written 4.1 years ago by nasromer219198920
0
gravatar for Pierre Lindenbaum
4.1 years ago by
France/Nantes/Institut du Thorax - INSERM UMR1087
Pierre Lindenbaum131k wrote:

BLAT your sequence using the UCSC https://genome.ucsc.edu/cgi-bin/hgBlat , you'll find that the best match overlap the human gene SKA2

ADD COMMENTlink written 4.1 years ago by Pierre Lindenbaum131k

I use blastn locally use the miRNAs sequences against the est & gss database and I get this list of sequences

gb|BZ605061.1|BZ605061 WHADP35TF Human MCF7 breast cancer cell line library (MCF7_1) Homo sapiens genomic clone MCF7_1-22F22, genomic survey sequence GGCTGAGCCGCAGTAGTTCTTCAGTGGCAAGCT gb|AQ702366.1|AQ702366 HS_5431_A1_E07_T7A RPCI-11 Human Male BAC Library Homo sapiens genomic clone Plate=1007 Col=13 Row=I, genomic survey sequence CAAGTCACTAGTGGTTCGGTTTAGTAGATGATTGTGCATTGTTTCAAANTGGTGCCNTAGTGACTACAAAGCCC gb|BZ606208.1|BZ606208 WHACE55TF Human MCF7 breast cancer cell line library (MCF7_1) Homo sapiens genomic clone MCF7_1-14I13, genomic survey sequence ACTGCTAACGAATGCTCTGACTTTATTGCACTACTGTACTTTACAGCTAGCAGTGCAATAGTATTGTCAAAGCATCTGAAAGCAGG gb|AQ000516.1|AQ000516 CIT-HSP-2289P16.TR CIT-HSP Homo sapiens genomic clone 2289P16, genomic survey sequence CCACCACTTAAACGTGGATGTACTTGCTTTGAAACTAAAGAAGTAAGTGCTTCCATGTTTTGGTGATGG gb|AQ939510.1|AQ939510 NR1-235R Human NotI clones Homo sapiens genomic, genomic survey sequence GCGACGAGCCCCTCGCACAAACCGGACCTGAGCGTTTTGTTCGTTCGGCTCGCATGA gb|KS361709.1|KS361709 RIS29306 Control and insulated FV vector RIS library Homo sapiens genomic clone CD34_Liquid_FVSGW650cHS4_Day10_1660 similar to CD34_Liquid_FVSGW650cHS4_Day10_1660, genomic survey sequence CTGTGTGTGATGAGCTGGCAGTGTATTGTTAGCTGGTTGAATATGTGAATGGCATCGGCTAACATGCAACTGCTGTCTTATTGCATATACA so I need to know the name of the gene???? thanks

ADD REPLYlink written 4.1 years ago by nasromer219198920
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2238 users visited in the last hour