intarprat blastn result
1
0
Entering edit mode
7.8 years ago

I get this sequence from blastn searching for similarity how can I get the name of the gene ?

gb|BZ606208.1|BZ606208 WHACE55TF Human MCF7 breast cancer cell line library (MCF7_1) Homo sapiens genomic clone MCF7_1-14I13, genomic survey sequence ACTGCTAACGAATGCTCTGACTTTATTGCACTACTGTACTTTACAGCTAGCAGTGCAATAGTATTGTCAAAGCATCTGAAAGCAGG

blast • 1.4k views
ADD COMMENT
0
Entering edit mode
7.8 years ago

BLAT your sequence using the UCSC https://genome.ucsc.edu/cgi-bin/hgBlat , you'll find that the best match overlap the human gene SKA2

ADD COMMENT
0
Entering edit mode

I use blastn locally use the miRNAs sequences against the est & gss database and I get this list of sequences

gb|BZ605061.1|BZ605061 WHADP35TF Human MCF7 breast cancer cell line library (MCF7_1) Homo sapiens genomic clone MCF7_1-22F22, genomic survey sequence GGCTGAGCCGCAGTAGTTCTTCAGTGGCAAGCT gb|AQ702366.1|AQ702366 HS_5431_A1_E07_T7A RPCI-11 Human Male BAC Library Homo sapiens genomic clone Plate=1007 Col=13 Row=I, genomic survey sequence CAAGTCACTAGTGGTTCGGTTTAGTAGATGATTGTGCATTGTTTCAAANTGGTGCCNTAGTGACTACAAAGCCC gb|BZ606208.1|BZ606208 WHACE55TF Human MCF7 breast cancer cell line library (MCF7_1) Homo sapiens genomic clone MCF7_1-14I13, genomic survey sequence ACTGCTAACGAATGCTCTGACTTTATTGCACTACTGTACTTTACAGCTAGCAGTGCAATAGTATTGTCAAAGCATCTGAAAGCAGG gb|AQ000516.1|AQ000516 CIT-HSP-2289P16.TR CIT-HSP Homo sapiens genomic clone 2289P16, genomic survey sequence CCACCACTTAAACGTGGATGTACTTGCTTTGAAACTAAAGAAGTAAGTGCTTCCATGTTTTGGTGATGG gb|AQ939510.1|AQ939510 NR1-235R Human NotI clones Homo sapiens genomic, genomic survey sequence GCGACGAGCCCCTCGCACAAACCGGACCTGAGCGTTTTGTTCGTTCGGCTCGCATGA gb|KS361709.1|KS361709 RIS29306 Control and insulated FV vector RIS library Homo sapiens genomic clone CD34_Liquid_FVSGW650cHS4_Day10_1660 similar to CD34_Liquid_FVSGW650cHS4_Day10_1660, genomic survey sequence CTGTGTGTGATGAGCTGGCAGTGTATTGTTAGCTGGTTGAATATGTGAATGGCATCGGCTAACATGCAACTGCTGTCTTATTGCATATACA so I need to know the name of the gene???? thanks

ADD REPLY

Login before adding your answer.

Traffic: 2849 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6