Question: Need to separate paired-end reads from single fastq file.
0
gravatar for basharatbhat09
3.0 years ago by
basharatbhat090 wrote:

Hi there,

I have paired-end reads (in fastq format) merged in a single fastq file, i need to split them into two files please help,

Data is; @HWI-700463F:192:C9M9YANXX:6:1101:1397:2190 1:N:0:CGATGTAT CGAGGACCATGGACACAGCAGAACAAGATGAAGACACCAGGGCTAGGTAATTCCTTGTGAGGGCAGGACCAGCACTTCTGTGTTGCTGTCCCTATGGGAA + BBBBBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

@HWI-700463F:192:C9M9YANXX:6:1101:1397:2190 2:N:0:CGATGTAT GCTTTTTTTGCATAGGCATTACTCAGGATCTGAATGGGTTGGGAGGCCGGTGTGGAAGGTGGTTAGGAGCCCAAAGCTAACTGTTCCCATAGGGACAGCA + BBBBBFFFFFFFFBFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFF<fbffffffffffffffffffffffffffffffffffff&lt;7ffff< p="">

does 1 in "1:N:0:CGATGTAT" means forward read and 2 in "2:N:0:CGATGTAT" mean reverse read..

sequencing snp rna-seq • 5.5k views
ADD COMMENTlink modified 2.4 years ago by bhao.haob10 • written 3.0 years ago by basharatbhat090
2

You have a lot of great friends to ask this question: google, biostars, seqanswers ... This question has been asked several times. I recommend you to try to solve the problems yourself before asking, you'll learn more and you'll feel fully realized. Take a look:

ADD REPLYlink modified 3.0 years ago • written 3.0 years ago by iraun3.6k
1
gravatar for bhao.haob
2.4 years ago by
bhao.haob10
bhao.haob10 wrote:

Hi Basharat, this might be coming too late but I thought this thread Fastq Splitter For Paired End Reads might me useful.

ADD COMMENTlink written 2.4 years ago by bhao.haob10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 905 users visited in the last hour