In silico PCR with BAM files?
0
0
Entering edit mode
4.4 years ago
zaroteary • 0

Dear all,

I have a .fa file for my organism and several .bam files for my isolates. I have designed some PCR primers for the isolates. Are there any programs that would allow me to run In silico PCR with the bam files?

Thank you.

PCR BAM • 1000 views
ADD COMMENT
0
Entering edit mode

Hi zaroteary, Maybe you can convert your bam files to fasta - check BAM/SAM to FASTA conversion and then use in-silico PCR from UCSC ( download http://hgwdev.cse.ucsc.edu/~kent/exe/linux/isPcr.zip).

ADD REPLY
0
Entering edit mode

After I converted my BAM file to FASTA, the sequences are all in fragments of ~100 bp with overlaps. Example:

HS1:369:C3W70ACXX:8:1312:17711:59403/2 TAAACCCTAAACCCTAAACCCTAAACCCTCTCAAATCTGGTCATCATTTTTGACCGGATATTAGGTTTCATAAAACTGTAAAGTTACATACCTGTCAAAT HS1:369:C3W70ACXX:8:2113:18337:16744/2 AACCCTAAACCCTAAACCCTCTCAAATCTGGTCATCATTTTTGACCGGATATTAGGTTTCATAAAACTGTAAAGTTACATACCTGTCAAATCCGATCAAT HS1:369:C3W70ACXX:8:2111:18597:56001/1 GATTGATCGGATTTGACAGGTATGTAACTTTACAGTTTTATGAAACCTAATATCCGGTCAAAAATGATGACCAGATTTGAGAGGGTTTAGGGTTTAGGGT

Do I need to reconstruct the genome before going into in-silico PCR? If so, how do I do it? Sorry, if this is a stupid question, I'm new to all these...

ADD REPLY

Login before adding your answer.

Traffic: 2133 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6