Question: In silico PCR with BAM files?
0
gravatar for zaroteary
3.1 years ago by
zaroteary0
zaroteary0 wrote:

Dear all,

I have a .fa file for my organism and several .bam files for my isolates. I have designed some PCR primers for the isolates. Are there any programs that would allow me to run In silico PCR with the bam files?

Thank you.

pcr bam • 711 views
ADD COMMENTlink written 3.1 years ago by zaroteary0

Hi zaroteary, Maybe you can convert your bam files to fasta - check BAM/SAM to FASTA conversion and then use in-silico PCR from UCSC ( download http://hgwdev.cse.ucsc.edu/~kent/exe/linux/isPcr.zip).

ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by rozanskide0

After I converted my BAM file to FASTA, the sequences are all in fragments of ~100 bp with overlaps. Example:

HS1:369:C3W70ACXX:8:1312:17711:59403/2 TAAACCCTAAACCCTAAACCCTAAACCCTCTCAAATCTGGTCATCATTTTTGACCGGATATTAGGTTTCATAAAACTGTAAAGTTACATACCTGTCAAAT HS1:369:C3W70ACXX:8:2113:18337:16744/2 AACCCTAAACCCTAAACCCTCTCAAATCTGGTCATCATTTTTGACCGGATATTAGGTTTCATAAAACTGTAAAGTTACATACCTGTCAAATCCGATCAAT HS1:369:C3W70ACXX:8:2111:18597:56001/1 GATTGATCGGATTTGACAGGTATGTAACTTTACAGTTTTATGAAACCTAATATCCGGTCAAAAATGATGACCAGATTTGAGAGGGTTTAGGGTTTAGGGT

Do I need to reconstruct the genome before going into in-silico PCR? If so, how do I do it? Sorry, if this is a stupid question, I'm new to all these...

ADD REPLYlink written 3.1 years ago by zaroteary0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 730 users visited in the last hour