Question: How to Design Methylation Primer for LINE-1 to Indicate Genome-wide DNA methylation
0
gravatar for Shicheng Guo
2.3 years ago by
Shicheng Guo7.4k
Shicheng Guo7.4k wrote:

Hi All,

Usually, we will apply the methylation level of Line-1 to indicate the globe DNA methylation level, however, since Line-1 is kind of repeat sequence, How to design a universal primer to duplicate all the Line-1 sequence in human genome?

Line-1 Methylation Primer Set-1

5′-GGACGTATTTGGAAAATCGGG-3′ 
5′-AATCTCGCGATACGCCGTT-3′ 
5′-TCGAATATTGCGTTTTCGGATCGGTTT-3′

Line-1 Methylation Primer Set-2

5′-TTGAGTTGTGGTGGGTTTTATTTAG-3′ 
5′-TCATCTCACTAAAAAATACCAAACA-3′.

Line-1 Methylation Primer Set-3

5’-TTGGTTAGGTGTGGGATATAGTT-3’
5’-CAAAAAATCAAAAAATTCCCTTTCC-3’

Line-1 Methylation Primer Set-4

Line-1 F     5′TTATTAGGGAGTGTTAGATAGTGGG3′
Line-1 R     5′CCTCTAAACCAAATATAAAAT ATAATCTC3′;
ALU-C4 F     5’GGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA3’
ALU-C4 R     5’ATTAACTAAACTAATCTTAAACTCCTAACCTCA3’
----------------------------------------------
Line-1 met      VIC–TACTTCGACTCGCGCACGATA-MBG3'
Line-1 unmet    6FAM–CCTACTTCAACTCACACA-MBG3'
ALU-C4          6FAM-CCTACCTTAACCTCCC-MGB3'
----------------------------------------------

Thanks.

methylation line-1 forum • 986 views
ADD COMMENTlink modified 4 months ago • written 2.3 years ago by Shicheng Guo7.4k
0
gravatar for Shicheng Guo
6 months ago by
Shicheng Guo7.4k
Shicheng Guo7.4k wrote:
>X58075.1 Human LINE-1 transposon (L1Hs) DNA
GGGGGAGGAGCCAAGATGGCCGAATAGGAACAGCTCCGGTCTACAGCTCCCAGCGTGAGCGACGCAGAAG
ACGGGTGATTTCTGCATTTCCATCTGAGGTACCGGGTTCATCTCACTAGGGAGTGCCAGACAGTGGGCGC
AGGCCACTGTGTGCGCGCACCGTGCGCGAGCCGAAGCAGGGCGAGGCATTGCCTCACCTGGGAAGCGCAA
GGGGTCAGGGAGTTCCCTTTCCGAGTCAAAGAAAGGGGTGACGGACGCACCTGGAAAATCGGGTCACTCC
CACCCGAATATTGCGCTTTTCAGACCGGCTTAAGAAACGGCGCACCACGAGACTATATCCCACACCTGGC
TCAGAGGGTCCTACGCCCACGGAATCTCGCTGATTGCTAGCACAGCAGTCTGAGATCAAACTGCAAGGCG
GCAACGAGGCTGGGGGAGGGGCGCCCGCCATTGCCCAGGCTTGCTTAGGTAAACAAAGCAGCCGGGAAGC
TCGAACTGGGTGGAGCCCACCACAGCTCAAGGAGGCCTACCTGCCTCTGTAGGCTCCACCTCTGGGGGCA
GGGCACAGACAAACAAAAAGACAGCAGTAACCTCTGCAGACTTAAGTGTCCCTGTCTGACAGCTTTGAAG
AGAGCAGTGGTTCTCCCAGCACGCAGCTGGAGATCTGAGAACGGGCAGACTGCCTCCTCAAGTGGGTCCC
TGACCCCTGACCCCCGAGCAGCCTAACTGGGAGGCACCCCCCAGCAGGGCACACTGACACCTCACACGGC
AGGGTATTCCAACAGACCTGCAGCTGAGGGTCCTGTCTGTTAGAAGGAAAACTAACAACCAGAAAGGACA
TCTACACGAAAACCCATCTGTACATCACCATCATCAAAGACCAAAAGTAGATAAAACCACAAAGATGGGG
AAAAAACAGAACAGAAAAACTGGAAACTCTAAAACGCAGAGGCCCTCTCCTCCTCCAAAGGAACGCAGTT
CCTCACCAGCAACAGAACAAAGCTGGATGGAGAATGATTTTGACGAGCTGAGAGAAGAAGGCTTCAGACG
ATCAAATTACTCTGAGCTACAGGAGGACATTCAAACCAAAGGCAAAGAAGTTGAAAACTTTGAAAAAAAT
TTAGAAGAATGTATAACTAGAATAACC
ADD COMMENTlink written 6 months ago by Shicheng Guo7.4k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1008 users visited in the last hour