Missing BWA alignment score (AS) tag in SAM files
1
0
Entering edit mode
5.6 years ago
lironyoffe • 0

Hi,

I'm using BWA 0.7.12. sampe to align paired end reads. I would like to get the alignment score, but can't find AS tag in the SAM files. Same thing happens when using samse for single end reads.
Where did the AS tag go? Is there another way to get the alignment score? (I need it for a downstream analysis and can't use the mapping quality).

Thanks!

next-gen bwa sequencing • 2.0k views
ADD COMMENT
0
Entering edit mode
5.6 years ago
Sarthok ▴ 70

Please see this and this and the related post.

Using the bwa mem sould generate the AS score. I have just tested it by aligning PE reads with a reference genome and output is like this:

SRR1972739.3 131 AF086833 2587 60 81M20S = 2531 -57 GAATGATGAGAATAGATTTGTTACACTGGATGGTCAACAATTTTATTGGCCAGTAATGAATCACAGGAATAAATTCATGGCCTCTTTTTCAGTGAGCCATG CC@FFFFFHHHHHJJJJJJJJJJJJJJJJJJJJGIJJJJJJJJJJJJJIJJJJHHJIHJJIGIJIIJIJIJJJJJIIJIGHHHHFFFFFCCEEECCEDDC@ NM:i:5 MD:Z:6A18T25G2G10A15 AS:i:56 XS:i:0

ADD COMMENT
0
Entering edit mode

Thanks. I understand that for bwa mem the AS tag is printed, but what about sampe ad samse? My reads are ~50bp long and according to bwa manual the recommended algorithm is BWA-backtrack (sampe/samse).

ADD REPLY

Login before adding your answer.

Traffic: 1824 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6