Plasmodium berghei Alternative splicing sites ,how to predict if alternative splicing is happening or not ?any tool
1
0
Entering edit mode
4.8 years ago
krushnach80 ▴ 940

Im trying to clone my gene of interest and an I did my cloning efficiency is not that great but I think Im getting some intron region perhaps on the 3' end this is my gene of interest

"ATGAgtaaaaaaagaaaacaacatttattgaaacattaatgtctgcattgtacatgtttgcaaatataatgaagtgtatatttcccctgtgaatttgcaacatatctacataattttatataacaaacaaatgacataacttgctttctttcgcaatgctagcttatctgtacatacatatttatgttcagctttatcacgttcatccgttattttatatgcacataataaatatttttttttttttttttgttcagAATTTATCAGTTTTTCGAACCCAATCGAACTCTTTGAGTACATAAATAAAAAAGAGAATGACATTGAAGTTGTAGCATGCATTTTTACAAACTTACTCGGAAGTTTTTTTAAATGTTTTTTTTATGTAAATGATATATCTCTCAATAAGTTGGAAAAAGGATTTCCATTTGATGCATCATCAATCAAATTATGTTCAGATGCTGAAGTTAGCGATTTTTATTTAAGAGCTGATTATTCAACATGTTATACTGAAGAATTTCATGGAAAACAAATGTTAAATGTTTTATGTGATATAAAACGATATAATGGATTAGATTATTATAAATGCCCTAGAACAATTTTAAAAAAAGCTTGTGAACTTATTAAAAATGATAATATAGCAGATAATATATATATAGGAAATGAAATCGAGTTTTTTATTTTTGATAAAGTTAATTTTTTATCAGACGATTATAATACATACTTAAAAATATATGATAGGGAATCTTTTTCATGTAAAAATTATATACCAGAAGTATATAATAGTAATCCTATTAATGCAATTGAAGGGTGTAATAATAATAACAATAGTAGCACAAATGATGAACATTATAGTCTGCAAAGTTTAAATAGTATTTTCATT AATGATGATACAAAAAAAATAAAAAATAAATGTGGATATTTTTCAACAAGCCCTTATGATACTTCTGAATTAATAAAAGTTCAAATATGTCGTGATTTAAATAATTTGGGTATTAATGTACAGAAATATCATCATGAAGTATCAACTAGCCAACATGAAATTTCTTTAAAATATTTTAATGCATTAAAAAACGCTGATAATTTATTAATAGCTAAACAAATCATTAAAAAAAATGTACATAATTTTAATAGGACTGCTACTTTTATGCCTAAACCATTAGTAAATGACAACGGGAGTGGATTACATTGTAATATATCATTATGGAAAAATAATAGTAATATTTTTTATAGTGATGATCCATCTACATTTTTTATTTCAAAAGAATGTTTTTATTTTATGAATGGTATTATAAAACATACAAAGGCATTACAGGCTTTATGTAATTCAACTATTAATTCATATAAAAGATTAATGCCAGGTTTTGAAACAAGTCAAAAGCTATTTTATTCTTTTGGATCACGAAATGCTGTTATAAGATTATCTTTAATCAATTATAATAGTTCTTTGGAAAAAAGAATTGAATTTAGATTACCAGATTATGCAAACTCACCTCATCTGGTTTTAGCTGCTATAATTTTAGCTGGTTATGATGGTATACGATCTAAAGAAAAACCATTAGTGCCTTTAGAATCAAAAAACAATGAATTTTTTGTTTCAAATGTTTTTGAAAAATATGTTAGCAACAATAATAACTTCAGAATTCTTACCAACGCATTAAAAGATTATAAAGATGTACACGATGTTAAAGACAATCCAGAATTCATAAACTTCTTTAAATGTGAGGAACCGAATGATATTGCTTTTTCACTAAAGGAAAGCTTAGATGCTCTTGAACAGGACCACGATTTTTTAACTTATAACAGCGTATTTACCAAGgtttgtaaaaatccatatattttccttttttcataaatttgaacatgcttatatatatgtattctccaaatttataatgtattatgcatgttttattattttttaattaattttttttttcacagGAAATGATCAAAGAATATATACAATTTAAAAGGGAAGAAATTGCAGCTTTCGACAAAATCGTACATCCTTCTGAATTTATCATGTATTATGGATCTTAA"

This is from the plasmodb site the small letters are predicted intron even though Im using the processed sequenced that is intron spliced out but still Im getting intron im not sure or may be its alternative splicing

So can anyone tell me how do i predict the alternative splicing if its taking place please do suggest me I need help

sequence alignment • 1.5k views
ADD COMMENT
1
Entering edit mode
4.8 years ago
Satyajeet Khare ★ 1.6k

Predicting splicing or alternative splicing from sequence will be difficult in Plasmodium.

You can just blast it against transcriptome or genome. You can create a transcript fasta file using genome fasta and transcript gtf. Else, you can create a genome file and upload it onto a genome browser such as IGV along with gene gtf file. Then try to blat the sequence back onto the genome.

ADD COMMENT
0
Entering edit mode

okay can you explain me it in simpler terms I am new to this stuff I know how to use blast and align , but how do I create a transcript fasta file ?or transcript gtf file as far as I have read gtf is the annotation file I guess ?and again how do i blat it into the genome ?

Sorry for asking these pretty basic trivial stuffs but i'm quite new to these tool, if you can explain that would be really helpful

with regards

ADD REPLY
0
Entering edit mode

Okay.

Can you please confirm following?

  1. The sequence you mention is the genomic region (Pls provide genome version).
  2. You want to clone a cDNA.
  3. SO you isolated RNA, performed cDNA synthesis and used that cDNA for cloning
  4. And you saw intronic regions in your clones.

If yes, can you provide following information?

  1. Primer sequences used for cloning
  2. Sequencing results

Can you also confirm that sequencing result was clean and trustworthy? Especially small repeats are called correctly?

ADD REPLY
0
Entering edit mode

Gene ID: PBANKA_0823500

Table: Sequences [Transcript ID] [Transcript Length] [Protein Length] [Genomic Length] [UTR/Intron Coords] [5p UTR Coords] [3p UTR Coords] [Transcript Sequence] [Protein Sequence] [Genomic Sequence]
PBANKA_0823500.1 1662 553 2040 [["Intron",5,257],["Intron",1817,1941]] null null ATGAAATTTATCAGTTTTTCGAACCCAATCGAACTCTTTGAGTACATAAATAAAAAAGAGAATGACATTGAAGTTGTAGCATGCATTTTTACAAACTTACTCGGAAGTTTTTTTAAATGTTTTTTTTATGTAAATGATATATCTCTCAATAAGTTGGAAAAAGGATTTCCATTTGATGCATCATCAATCAAATTATGTTCAGATGCTGAAGTTAGCGATTTTTATTTAAGAGCTGATTATTCAACATGTTATACTGAAGAATTTCATGGAAAACAAATGTTAAATGTTTTATGTGATATAAAACGATATAATGGATTAGATTATTATAAATGCCCTAGAACAATTTTAAAAAAAGCTTGTGAACTTATTAAAAATGATAATATAGCAGATAATATATATATAGGAAATGAAATCGAGTTTTTTATTTTTGATAAAGTTAATTTTTTATCAGACGATTATAATACATACTTAAAAATATATGATAGGGAATCTTTTTCATGTAAAAATTATATACCAGAAGTATATAATAGTAATCCTATTAATGCAATTGAAGGGTGTAATAATAATAACAATAGTAGCACAAATGATGAACATTATAGTCTGCAAAGTTTAAATAGTATTTTCATTAATGATGATACAAAAAAAATAAAAAATAAATGTGGATATTTTTCAACAAGCCCTTATGATACTTCTGAATTAATAAAAGTTCAAATATGTCGTGATTTAAATAATTTGGGTATTAATGTACAGAAATATCATCATGAAGTATCAACTAGCCAACATGAAATTTCTTTAAAATATTTTAATGCATTAAAAAACGCTGATAATTTATTAATAGCTAAACAAATCATTAAAAAAAATGTACATAATTTTAATAGGACTGCTACTTTTATGCCTAAACCATTAGTAAATGACAACGGGAGTGGATTACATTGTAATATATCATTATGGAAAAATAATAGTAATATTTTTTATAGTGATGATCCATCTACATTTTTTATTTCAAAAGAATGTTTTTATTTTATGAATGGTATTATAAAACATACAAAGGCATTACAGGCTTTATGTAATTCAACTATTAATTCATATAAAAGATTAATGCCAGGTTTTGAAACAAGTCAAAAGCTATTTTATTCTTTTGGATCACGAAATGCTGTTATAAGATTATCTTTAATCAATTATAATAGTTCTTTGGAAAAAAGAATTGAATTTAGATTACCAGATTATGCAAACTCACCTCATCTGGTTTTAGCTGCTATAATTTTAGCTGGTTATGATGGTATACGATCTAAAGAAAAACCATTAGTGCCTTTAGAATCAAAAAACAATGAATTTTTTGTTTCAAATGTTTTTGAAAAATATGTTAGCAACAATAATAACTTCAGAATTCTTACCAACGCATTAAAAGATTATAAAGATGTACACGATGTTAAAGACAATCCAGAATTCATAAACTTCTTTAAATGTGAGGAACCGAATGATATTGCTTTTTCACTAAAGGAAAGCTTAGATGCTCTTGAACAGGACCACGATTTTTTAACTTATAACAGCGTATTTACCAAGGAAATGATCAAAGAATATATACAATTTAAAAGGGAAGAAATTGCAGCTTTCGACAAAATCGTACATCCTTCTGAATTTATCATGTATTATGGATCTTAA MKFISFSNPIELFEYINKKENDIEVVACIFTNLLGSFFKCFFYVNDISLNKLEKGFPFDASSIKLCSDAEVSDFYLRADYSTCYTEEFHGKQMLNVLCDIKRYNGLDYYKCPRTILKKACELIKNDNIADNIYIGNEIEFFIFDKVNFLSDDYNTYLKIYDRESFSCKNYIPEVYNSNPINAIEGCNNNNNSSTNDEHYSLQSLNSIFINDDTKKIKNKCGYFSTSPYDTSELIKVQICRDLNNLGINVQKYHHEVSTSQHEISLKYFNALKNADNLLIAKQIIKKNVHNFNRTATFMPKPLVNDNGSGLHCNISLWKNNSNIFYSDDPSTFFISKECFYFMNGIIKHTKALQALCNSTINSYKRLMPGFETSQKLFYSFGSRNAVIRLSLINYNSSLEKRIEFRLPDYANSPHLVLAAIILAGYDGIRSKEKPLVPLESKNNEFFVSNVFEKYVSNNNNFRILTNALKDYKDVHDVKDNPEFINFFKCEEPNDIAFSLKESLDALEQDHDFLTYNSVFTKEMIKEYIQFKREEIAAFDKIVHPSEFIMYYGS ATGAGTAAAAAAAGAAAACAACATTTATTGAAACATTAATGTCTGCATTGTACATGTTTGCAAATATAATGAAGTGTATATTTCCCCTGTGAATTTGCAACATATCTACATAATTTTATATAACAAACAAATGACATAACTTGCTTTCTTTCGCAATGCTAGCTTATCTGTACATACATATTTATGTTCAGCTTTATCACGTTCATCCGTTATTTTATATGCACATAATAAATATTTTTTTTTTTTTTTTTGTTCAGAATTTATCAGTTTTTCGAACCCAATCGAACTCTTTGAGTACATAAATAAAAAAGAGAATGACATTGAAGTTGTAGCATGCATTTTTACAAACTTACTCGGAAGTTTTTTTAAATGTTTTTTTTATGTAAATGATATATCTCTCAATAAGTTGGAAAAAGGATTTCCATTTGATGCATCATCAATCAAATTATGTTCAGATGCTGAAGTTAGCGATTTTTATTTAAGAGCTGATTATTCAACATGTTATACTGAAGAATTTCATGGAAAACAAATGTTAAATGTTTTATGTGATATAAAACGATATAATGGATTAGATTATTATAAATGCCCTAGAACAATTTTAAAAAAAGCTTGTGAACTTATTAAAAATGATAATATAGCAGATAATATATATATAGGAAATGAAATCGAGTTTTTTATTTTTGATAAAGTTAATTTTTTATCAGACGATTATAATACATACTTAAAAATATATGATAGGGAATCTTTTTCATGTAAAAATTATATACCAGAAGTATATAATAGTAATCCTATTAATGCAATTGAAGGGTGTAATAATAATAACAATAGTAGCACAAATGATGAACATTATAGTCTGCAAAGTTTAAATAGTATTTTCATTAATGATGATACAAAAAAAATAAAAAATAAATGTGGATATTTTTCAACAAGCCCTTATGATACTTCTGAATTAATAAAAGTTCAAATATGTCGTGATTTAAATAATTTGGGTATTAATGTACAGAAATATCATCATGAAGTATCAACTAGCCAACATGAAATTTCTTTAAAATATTTTAATGCATTAAAAAACGCTGATAATTTATTAATAGCTAAACAAATCATTAAAAAAAATGTACATAATTTTAATAGGACTGCTACTTTTATGCCTAAACCATTAGTAAATGACAACGGGAGTGGATTACATTGTAATATATCATTATGGAAAAATAATAGTAATATTTTTTATAGTGATGATCCATCTACATTTTTTATTTCAAAAGAATGTTTTTATTTTATGAATGGTATTATAAAACATACAAAGGCATTACAGGCTTTATGTAATTCAACTATTAATTCATATAAAAGATTAATGCCAGGTTTTGAAACAAGTCAAAAGCTATTTTATTCTTTTGGATCACGAAATGCTGTTATAAGATTATCTTTAATCAATTATAATAGTTCTTTGGAAAAAAGAATTGAATTTAGATTACCAGATTATGCAAACTCACCTCATCTGGTTTTAGCTGCTATAATTTTAGCTGGTTATGATGGTATACGATCTAAAGAAAAACCATTAGTGCCTTTAGAATCAAAAAACAATGAATTTTTTGTTTCAAATGTTTTTGAAAAATATGTTAGCAACAATAATAACTTCAGAATTCTTACCAACGCATTAAAAGATTATAAAGATGTACACGATGTTAAAGACAATCCAGAATTCATAAACTTCTTTAAATGTGAGGAACCGAATGATATTGCTTTTTCACTAAAGGAAAGCTTAGATGCTCTTGAACAGGACCACGATTTTTTAACTTATAACAGCGTATTTACCAAGGTTTGTAAAAATCCATATATTTTCCTTTTTTCATAAATTTGAACATGCTTATATATATGTATTCTCCAAATTTATAATGTATTATGCATGTTTTATTATTTTTTAATTAATTTTTTTTTTCACAGGAAATGATCAAAGAATATATACAATTTAAAAGGGAAGAAATTGCAGCTTTCGACAAAATCGTACATCCTTCTGAATTTATCATGTATTATGGATCTTAA

All the stuffs Im pasting here

ADD REPLY

Login before adding your answer.

Traffic: 1349 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6