Question: Plasmodium berghei Alternative splicing sites ,how to predict if alternative splicing is happening or not ?any tool
0
gravatar for krushnach80
2.3 years ago by
krushnach80470
krushnach80470 wrote:

Im trying to clone my gene of interest and an I did my cloning efficiency is not that great but I think Im getting some intron region perhaps on the 3' end this is my gene of interest

"ATGAgtaaaaaaagaaaacaacatttattgaaacattaatgtctgcattgtacatgtttgcaaatataatgaagtgtatatttcccctgtgaatttgcaacatatctacataattttatataacaaacaaatgacataacttgctttctttcgcaatgctagcttatctgtacatacatatttatgttcagctttatcacgttcatccgttattttatatgcacataataaatatttttttttttttttttgttcagAATTTATCAGTTTTTCGAACCCAATCGAACTCTTTGAGTACATAAATAAAAAAGAGAATGACATTGAAGTTGTAGCATGCATTTTTACAAACTTACTCGGAAGTTTTTTTAAATGTTTTTTTTATGTAAATGATATATCTCTCAATAAGTTGGAAAAAGGATTTCCATTTGATGCATCATCAATCAAATTATGTTCAGATGCTGAAGTTAGCGATTTTTATTTAAGAGCTGATTATTCAACATGTTATACTGAAGAATTTCATGGAAAACAAATGTTAAATGTTTTATGTGATATAAAACGATATAATGGATTAGATTATTATAAATGCCCTAGAACAATTTTAAAAAAAGCTTGTGAACTTATTAAAAATGATAATATAGCAGATAATATATATATAGGAAATGAAATCGAGTTTTTTATTTTTGATAAAGTTAATTTTTTATCAGACGATTATAATACATACTTAAAAATATATGATAGGGAATCTTTTTCATGTAAAAATTATATACCAGAAGTATATAATAGTAATCCTATTAATGCAATTGAAGGGTGTAATAATAATAACAATAGTAGCACAAATGATGAACATTATAGTCTGCAAAGTTTAAATAGTATTTTCATT AATGATGATACAAAAAAAATAAAAAATAAATGTGGATATTTTTCAACAAGCCCTTATGATACTTCTGAATTAATAAAAGTTCAAATATGTCGTGATTTAAATAATTTGGGTATTAATGTACAGAAATATCATCATGAAGTATCAACTAGCCAACATGAAATTTCTTTAAAATATTTTAATGCATTAAAAAACGCTGATAATTTATTAATAGCTAAACAAATCATTAAAAAAAATGTACATAATTTTAATAGGACTGCTACTTTTATGCCTAAACCATTAGTAAATGACAACGGGAGTGGATTACATTGTAATATATCATTATGGAAAAATAATAGTAATATTTTTTATAGTGATGATCCATCTACATTTTTTATTTCAAAAGAATGTTTTTATTTTATGAATGGTATTATAAAACATACAAAGGCATTACAGGCTTTATGTAATTCAACTATTAATTCATATAAAAGATTAATGCCAGGTTTTGAAACAAGTCAAAAGCTATTTTATTCTTTTGGATCACGAAATGCTGTTATAAGATTATCTTTAATCAATTATAATAGTTCTTTGGAAAAAAGAATTGAATTTAGATTACCAGATTATGCAAACTCACCTCATCTGGTTTTAGCTGCTATAATTTTAGCTGGTTATGATGGTATACGATCTAAAGAAAAACCATTAGTGCCTTTAGAATCAAAAAACAATGAATTTTTTGTTTCAAATGTTTTTGAAAAATATGTTAGCAACAATAATAACTTCAGAATTCTTACCAACGCATTAAAAGATTATAAAGATGTACACGATGTTAAAGACAATCCAGAATTCATAAACTTCTTTAAATGTGAGGAACCGAATGATATTGCTTTTTCACTAAAGGAAAGCTTAGATGCTCTTGAACAGGACCACGATTTTTTAACTTATAACAGCGTATTTACCAAGgtttgtaaaaatccatatattttccttttttcataaatttgaacatgcttatatatatgtattctccaaatttataatgtattatgcatgttttattattttttaattaattttttttttcacagGAAATGATCAAAGAATATATACAATTTAAAAGGGAAGAAATTGCAGCTTTCGACAAAATCGTACATCCTTCTGAATTTATCATGTATTATGGATCTTAA"

This is from the plasmodb site the small letters are predicted intron even though Im using the processed sequenced that is intron spliced out but still Im getting intron im not sure or may be its alternative splicing

So can anyone tell me how do i predict the alternative splicing if its taking place please do suggest me I need help

alignment sequence • 933 views
ADD COMMENTlink modified 2.3 years ago by Satyajeet Khare1.3k • written 2.3 years ago by krushnach80470
1
gravatar for Satyajeet Khare
2.3 years ago by
Satyajeet Khare1.3k
Pune, India
Satyajeet Khare1.3k wrote:

Predicting splicing or alternative splicing from sequence will be difficult in Plasmodium.

You can just blast it against transcriptome or genome. You can create a transcript fasta file using genome fasta and transcript gtf. Else, you can create a genome file and upload it onto a genome browser such as IGV along with gene gtf file. Then try to blat the sequence back onto the genome.

ADD COMMENTlink modified 2.3 years ago • written 2.3 years ago by Satyajeet Khare1.3k

okay can you explain me it in simpler terms I am new to this stuff I know how to use blast and align , but how do I create a transcript fasta file ?or transcript gtf file as far as I have read gtf is the annotation file I guess ?and again how do i blat it into the genome ?

Sorry for asking these pretty basic trivial stuffs but i'm quite new to these tool, if you can explain that would be really helpful

with regards

ADD REPLYlink written 2.3 years ago by krushnach80470

Okay.

Can you please confirm following?

  1. The sequence you mention is the genomic region (Pls provide genome version).
  2. You want to clone a cDNA.
  3. SO you isolated RNA, performed cDNA synthesis and used that cDNA for cloning
  4. And you saw intronic regions in your clones.

If yes, can you provide following information?

  1. Primer sequences used for cloning
  2. Sequencing results

Can you also confirm that sequencing result was clean and trustworthy? Especially small repeats are called correctly?

ADD REPLYlink modified 2.3 years ago • written 2.3 years ago by Satyajeet Khare1.3k

Gene ID: PBANKA_0823500

Table: Sequences [Transcript ID] [Transcript Length] [Protein Length] [Genomic Length] [UTR/Intron Coords] [5p UTR Coords] [3p UTR Coords] [Transcript Sequence] [Protein Sequence] [Genomic Sequence]
PBANKA_0823500.1 1662 553 2040 [["Intron",5,257],["Intron",1817,1941]] null null ATGAAATTTATCAGTTTTTCGAACCCAATCGAACTCTTTGAGTACATAAATAAAAAAGAGAATGACATTGAAGTTGTAGCATGCATTTTTACAAACTTACTCGGAAGTTTTTTTAAATGTTTTTTTTATGTAAATGATATATCTCTCAATAAGTTGGAAAAAGGATTTCCATTTGATGCATCATCAATCAAATTATGTTCAGATGCTGAAGTTAGCGATTTTTATTTAAGAGCTGATTATTCAACATGTTATACTGAAGAATTTCATGGAAAACAAATGTTAAATGTTTTATGTGATATAAAACGATATAATGGATTAGATTATTATAAATGCCCTAGAACAATTTTAAAAAAAGCTTGTGAACTTATTAAAAATGATAATATAGCAGATAATATATATATAGGAAATGAAATCGAGTTTTTTATTTTTGATAAAGTTAATTTTTTATCAGACGATTATAATACATACTTAAAAATATATGATAGGGAATCTTTTTCATGTAAAAATTATATACCAGAAGTATATAATAGTAATCCTATTAATGCAATTGAAGGGTGTAATAATAATAACAATAGTAGCACAAATGATGAACATTATAGTCTGCAAAGTTTAAATAGTATTTTCATTAATGATGATACAAAAAAAATAAAAAATAAATGTGGATATTTTTCAACAAGCCCTTATGATACTTCTGAATTAATAAAAGTTCAAATATGTCGTGATTTAAATAATTTGGGTATTAATGTACAGAAATATCATCATGAAGTATCAACTAGCCAACATGAAATTTCTTTAAAATATTTTAATGCATTAAAAAACGCTGATAATTTATTAATAGCTAAACAAATCATTAAAAAAAATGTACATAATTTTAATAGGACTGCTACTTTTATGCCTAAACCATTAGTAAATGACAACGGGAGTGGATTACATTGTAATATATCATTATGGAAAAATAATAGTAATATTTTTTATAGTGATGATCCATCTACATTTTTTATTTCAAAAGAATGTTTTTATTTTATGAATGGTATTATAAAACATACAAAGGCATTACAGGCTTTATGTAATTCAACTATTAATTCATATAAAAGATTAATGCCAGGTTTTGAAACAAGTCAAAAGCTATTTTATTCTTTTGGATCACGAAATGCTGTTATAAGATTATCTTTAATCAATTATAATAGTTCTTTGGAAAAAAGAATTGAATTTAGATTACCAGATTATGCAAACTCACCTCATCTGGTTTTAGCTGCTATAATTTTAGCTGGTTATGATGGTATACGATCTAAAGAAAAACCATTAGTGCCTTTAGAATCAAAAAACAATGAATTTTTTGTTTCAAATGTTTTTGAAAAATATGTTAGCAACAATAATAACTTCAGAATTCTTACCAACGCATTAAAAGATTATAAAGATGTACACGATGTTAAAGACAATCCAGAATTCATAAACTTCTTTAAATGTGAGGAACCGAATGATATTGCTTTTTCACTAAAGGAAAGCTTAGATGCTCTTGAACAGGACCACGATTTTTTAACTTATAACAGCGTATTTACCAAGGAAATGATCAAAGAATATATACAATTTAAAAGGGAAGAAATTGCAGCTTTCGACAAAATCGTACATCCTTCTGAATTTATCATGTATTATGGATCTTAA MKFISFSNPIELFEYINKKENDIEVVACIFTNLLGSFFKCFFYVNDISLNKLEKGFPFDASSIKLCSDAEVSDFYLRADYSTCYTEEFHGKQMLNVLCDIKRYNGLDYYKCPRTILKKACELIKNDNIADNIYIGNEIEFFIFDKVNFLSDDYNTYLKIYDRESFSCKNYIPEVYNSNPINAIEGCNNNNNSSTNDEHYSLQSLNSIFINDDTKKIKNKCGYFSTSPYDTSELIKVQICRDLNNLGINVQKYHHEVSTSQHEISLKYFNALKNADNLLIAKQIIKKNVHNFNRTATFMPKPLVNDNGSGLHCNISLWKNNSNIFYSDDPSTFFISKECFYFMNGIIKHTKALQALCNSTINSYKRLMPGFETSQKLFYSFGSRNAVIRLSLINYNSSLEKRIEFRLPDYANSPHLVLAAIILAGYDGIRSKEKPLVPLESKNNEFFVSNVFEKYVSNNNNFRILTNALKDYKDVHDVKDNPEFINFFKCEEPNDIAFSLKESLDALEQDHDFLTYNSVFTKEMIKEYIQFKREEIAAFDKIVHPSEFIMYYGS ATGAGTAAAAAAAGAAAACAACATTTATTGAAACATTAATGTCTGCATTGTACATGTTTGCAAATATAATGAAGTGTATATTTCCCCTGTGAATTTGCAACATATCTACATAATTTTATATAACAAACAAATGACATAACTTGCTTTCTTTCGCAATGCTAGCTTATCTGTACATACATATTTATGTTCAGCTTTATCACGTTCATCCGTTATTTTATATGCACATAATAAATATTTTTTTTTTTTTTTTTGTTCAGAATTTATCAGTTTTTCGAACCCAATCGAACTCTTTGAGTACATAAATAAAAAAGAGAATGACATTGAAGTTGTAGCATGCATTTTTACAAACTTACTCGGAAGTTTTTTTAAATGTTTTTTTTATGTAAATGATATATCTCTCAATAAGTTGGAAAAAGGATTTCCATTTGATGCATCATCAATCAAATTATGTTCAGATGCTGAAGTTAGCGATTTTTATTTAAGAGCTGATTATTCAACATGTTATACTGAAGAATTTCATGGAAAACAAATGTTAAATGTTTTATGTGATATAAAACGATATAATGGATTAGATTATTATAAATGCCCTAGAACAATTTTAAAAAAAGCTTGTGAACTTATTAAAAATGATAATATAGCAGATAATATATATATAGGAAATGAAATCGAGTTTTTTATTTTTGATAAAGTTAATTTTTTATCAGACGATTATAATACATACTTAAAAATATATGATAGGGAATCTTTTTCATGTAAAAATTATATACCAGAAGTATATAATAGTAATCCTATTAATGCAATTGAAGGGTGTAATAATAATAACAATAGTAGCACAAATGATGAACATTATAGTCTGCAAAGTTTAAATAGTATTTTCATTAATGATGATACAAAAAAAATAAAAAATAAATGTGGATATTTTTCAACAAGCCCTTATGATACTTCTGAATTAATAAAAGTTCAAATATGTCGTGATTTAAATAATTTGGGTATTAATGTACAGAAATATCATCATGAAGTATCAACTAGCCAACATGAAATTTCTTTAAAATATTTTAATGCATTAAAAAACGCTGATAATTTATTAATAGCTAAACAAATCATTAAAAAAAATGTACATAATTTTAATAGGACTGCTACTTTTATGCCTAAACCATTAGTAAATGACAACGGGAGTGGATTACATTGTAATATATCATTATGGAAAAATAATAGTAATATTTTTTATAGTGATGATCCATCTACATTTTTTATTTCAAAAGAATGTTTTTATTTTATGAATGGTATTATAAAACATACAAAGGCATTACAGGCTTTATGTAATTCAACTATTAATTCATATAAAAGATTAATGCCAGGTTTTGAAACAAGTCAAAAGCTATTTTATTCTTTTGGATCACGAAATGCTGTTATAAGATTATCTTTAATCAATTATAATAGTTCTTTGGAAAAAAGAATTGAATTTAGATTACCAGATTATGCAAACTCACCTCATCTGGTTTTAGCTGCTATAATTTTAGCTGGTTATGATGGTATACGATCTAAAGAAAAACCATTAGTGCCTTTAGAATCAAAAAACAATGAATTTTTTGTTTCAAATGTTTTTGAAAAATATGTTAGCAACAATAATAACTTCAGAATTCTTACCAACGCATTAAAAGATTATAAAGATGTACACGATGTTAAAGACAATCCAGAATTCATAAACTTCTTTAAATGTGAGGAACCGAATGATATTGCTTTTTCACTAAAGGAAAGCTTAGATGCTCTTGAACAGGACCACGATTTTTTAACTTATAACAGCGTATTTACCAAGGTTTGTAAAAATCCATATATTTTCCTTTTTTCATAAATTTGAACATGCTTATATATATGTATTCTCCAAATTTATAATGTATTATGCATGTTTTATTATTTTTTAATTAATTTTTTTTTTCACAGGAAATGATCAAAGAATATATACAATTTAAAAGGGAAGAAATTGCAGCTTTCGACAAAATCGTACATCCTTCTGAATTTATCATGTATTATGGATCTTAA

All the stuffs Im pasting here

ADD REPLYlink written 2.3 years ago by krushnach80470
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1913 users visited in the last hour