Question: Do I have to look for sequence or reverse complement?
0
gravatar for eyb
3.1 years ago by
eyb180
Russian Federation
eyb180 wrote:

I have a gene reference sequence I downloaded from NCBI: https://www.ncbi.nlm.nih.gov/gene/102267223#reference-sequences I've read a paper and wanted to do a little sanity check mostly for educational purposes. Basically I want to find primers in a reference sequence. The primers are for example:

E8-S GCTAACCTCTCTGGACCACCTTC 
E8-A TGTCAGCCTCAGGAACACCC

I could find Start primer, but couldn't find Abort primer. The command I am using to find primers is:

In [74]: yak_2.seq.find("GCTAACCTCTCTGGACCACCTTC")
Out[74]: 35708

When I tried to search for reverse_compliment() did not find anything. Am I doing something stupidly wrong?

Thanks.

biopython sequence • 1.5k views
ADD COMMENTlink modified 3.1 years ago by william.bill.langdon30 • written 3.1 years ago by eyb180

How did you search for reverse_complement? Just to be sure that's not where things went wrong...

ADD REPLYlink written 3.1 years ago by WouterDeCoster42k
In [86]: dna = Seq("GCTAACCTCTCTGGACCACCTTC")
In [87]: dna.reverse_complement
Out[87]: <bound method Seq.reverse_complement of Seq('GCTAACCTCTCTGGACCACCTTC', Alphabet())>
In [88]: dna.reverse_complement()
Out[88]: Seq('GAAGGTGGTCCAGAGAGGTTAGC', Alphabet())
In [90]: yak_2.seq.find(dna.reverse_complement())
Out[90]: -1
ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by eyb180

Can't think of what is wrong right now. But I assume the S and A stand for sense and antisense. When I use those primers for in silico pcr on the UCSC genome browser I find a product matching the correct gene.

ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by WouterDeCoster42k
2

If A is the antisense primer, I guess that means op needs to revcomp the E8-A sequence TGTCAGCCTCAGGAACACCC not the sense one. In general I would search both primers in both directions.

ADD REPLYlink written 3.1 years ago by Michael Dondrup47k

I've searched for reverse compliment of antisense primer, but it does not find anything.

ADD REPLYlink written 3.1 years ago by eyb180
0
gravatar for william.bill.langdon
3.1 years ago by
william.bill.langdon30 wrote:

Many of the popular DNA sequence matching tools (eg BWA, BarraCUDA, Bowtie2) include looking for the antisense match by default. Bill

ADD COMMENTlink written 3.1 years ago by william.bill.langdon30
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1059 users visited in the last hour