Question: Illumina Miseq fastq file, barcode or no barcode? for Qiime Processing
0
gravatar for nidhiv
2.1 years ago by
nidhiv0
nidhiv0 wrote:

Hello

The following is the head for one of my paired fastq file:

@HWI-M04771:60:000000000-AURUP:1:1101:15803:1815 1:N:0:TGAGGTTTGATG
TACGGGGGATGCAAGCGTTATCCGGAATCATTGGGCGTAAAGCGCCTGTAGGTTGTTTAGTAAGTCCATTGTTAAAGACCAGGGCTTAACCCTGGGAAAGCAATAGAAACTACTAGACTTGAGTATGGCAGGGGTAGAGGGAATTTCTAGTGTAGCGGTGAAATGCGTAGATATTAGAAAGAACACCGGTGGCGAAAGCGCTCTACTGGACCATTACTGACACTGAGAGGCGAAAGCTAGGGTAGCAAAAGGG
+
BBBBBBFBBBFFEGGCEFGAGAGGGFFF3CAGFGGGHHGGFHFACEEGGGGGEGFEGFHDGHHGHFF<BGHGHHHH>BCCGCCHHFFGGFEEGFC2HGDFEG3FDGG@FGGDGGHFGFGDHHGHFDF?<GHFFHFGFFFDHHGHHHHHGCGHHHGHHHGHHHEGE=DFHHHHHHHHHHHHHEE0EFEAA@DEEHFECEFA?ADBHGGGGGB;BFFHGFEFGFHHGHEEECGGGGGGFFGGGFFFFFFFB>3>>

Since the index sequence is present in the first line, does that imply I need to process it and match it with a separate barcode fastq file using split_libraries_fast.py. I haven't received a barcode file as such from the sequencing lab and want confirm if I need to have that.

Do I have to include it in my mapping file?

Any help is appreciated a lot!

Thanks!

qiime miseq barcode • 1.8k views
ADD COMMENTlink modified 2.1 years ago by Devon Ryan87k • written 2.1 years ago by nidhiv0

I'm not familiar with Qiime, but this looks like the run has been demultiplexed (split into barcodes) and the barcodes have been clipped.

ADD REPLYlink written 2.1 years ago by WouterDeCoster36k

These samples are already demultiplexed. See the section on "working with already demultiplexed files" in this QIIME tutorial.

ADD REPLYlink written 2.1 years ago by genomax60k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1310 users visited in the last hour