Question: Possible adapter on the forward sequence,
gravatar for fkm.022
21 months ago by
fkm.0220 wrote:

HI, I have paired end sequences, when I do QC on my forward sequences, it showed overrepresented sequence indicating that as an adapter. TruSeq Adapter, Index 9 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATCAGATCTCGTATGCCGTCTTCTGCTTG However, in the reverse sequences are totally good. The scenario is that usually we have to trim the overrepresented sequences. So I have tried to trim it by Cutadapt using similar to this command line cutadapt -a AACCGGTT input.fastq > output.fastq Cutadapt has removed these sequence but I got bad sequence and I lost huge data.

My question is that is this Ok about losing huge data. Also, where if did not trim the overrepresented sequence will affect my mapping later on?

ADD COMMENTlink modified 21 months ago by Biostar ♦♦ 20 • written 21 months ago by fkm.0220

If you have adapter in read 1, you should have it in read 2 also unless the run was asymmetric (R1 and R2 different lengths). BBDuk has an option (tpe) for trimming paired reads to the same length even if adapter sequence was only detected in one read, for this reason; the quality of read 2 could be so low that the adapter sequence is not obvious due to too many mismatches. And yes, trimming adapters is important for mapping; you will get higher mapping speed, higher percent mapped, and more accurate mapq generation with trimmed reads.

ADD REPLYlink written 21 months ago by Brian Bushnell15k

Thank you for your comments and what you have said is helpful. Both reads have really good qc report.

ADD REPLYlink written 21 months ago by fkm.0220

Have you checked to see if R1/R2 reads merge (i.e. if you have shorter than expected inserts)? You can check this with from BBMap suite.

ADD REPLYlink modified 21 months ago • written 21 months ago by genomax55k

thank you for mention this and I will work in this today and I will respond on it.

ADD REPLYlink written 21 months ago by fkm.0220

Hi, Just to be sure, you have actually used the correct adapter sequence in the command line as noted here, and not the dummy (AACCGGTT) you have stated.

ADD REPLYlink written 21 months ago by agoel30

Thank you for your respond. yes used the actual adapter sequence.

ADD REPLYlink written 21 months ago by fkm.0220
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1042 users visited in the last hour