Pre-miRNA strcuture presentation
1
1
Entering edit mode
5.0 years ago
itsanju87 ▴ 10

Hi all, Am trying to represent the secondary structure of the pre-miRNA in the manuscript. The strcuture generated using RNAfold is not very clear. So am trying to represent it in sum other way. In few articles i came across the structure well represented. Can anyone suggest which technique i can use for presenting the secondary stem-loop structure?

sequence RNA-Seq • 1.2k views
ADD COMMENT
0
Entering edit mode
5.0 years ago

Similar post: A: How to get RNAfold (structure) output in text format

I had a Perl Module to output ASCII text of miRNA precursor secondary structure.

RNA::HairpinFigure - Draw hairpin-like text figure from RNA sequence and its secondary structure in dot-bracket notation.

Usage: http://search.cpan.org/dist/RNA-HairpinFigure/lib/RNA/HairpinFigure.pm#synopsis

   >hsa-mir-92a-1 MI0000093 Homo sapiens miR-92a-1 stem-loop
    CUUUCUACACAGGUUGGGAUCGGUUGCAAUGCUGUGUUUCUGUAUGGUAUUGCACUUGUCCCGGCCUGUUGAGUUUGG
    ..(((...((((((((((((.(((.(((((((((((......)))))))))))))).)))))))))))).))).....
    ---CU   UAC            C   U           UU 
         UUC   ACAGGUUGGGAU GGU GCAAUGCUGUG  U
         |||   |||||||||||| ||| |||||||||||   
         GAG   UGUCCGGCCCUG UCA CGUUAUGGUAU  G
    GGUUU   --U            U   -           GU
ADD COMMENT
0
Entering edit mode

Hi ran the first command, "perl makefile.pl"

C:\RNA-HairpinFigure-0.141212>perl Makefile.PL Generating a dmake-style Makefile Writing Makefile for RNA::HairpinFigure Writing MYMETA.yml and MYMETA.json

But the next command is not running, following error is popping up

C:\RNA-HairpinFigure-0.141212>make 'make' is not recognized as an internal or external command, operable program or batch file.

ADD REPLY
0
Entering edit mode

Install it via cpan in Windows/Linux...

cpan install RNA::HairpinFigure

For Windows, I recommend to use ActivePerl (download), so you can the "Perl Package Manager" (GUI). Search and install RNA::HairpinFigure

ADD REPLY
0
Entering edit mode

If you only have few sequences, you can also get the ASCII plot via our miRNA predicting server: FOMmiR, MicroRNA Prediction Using a Fixed-Order Markov Model Based on the Secondary Structure Pattern.

ADD REPLY
0
Entering edit mode

thank you it got installed. How to run the program with my sequence? since i have large data i cant run FOMniR.

ADD REPLY
0
Entering edit mode

Write perl script to parse RNAfold result and call this module. refer to http://search.cpan.org/dist/RNA-HairpinFigure/lib/RNA/HairpinFigure.pm#synopsis

ADD REPLY
0
Entering edit mode

The program runs good. BUt for few sequences, the structure is not coming properly. As like below, the base information is getting in two lines, one below the other also the pipe symbol for alignment. How to sort his out?

U              C   A              -      U       G       CGU        -   UC    C
      A         AAGUUUUU
 CCUUUGAUUAGAUA AAU GAAGGAUUCUGUAU AACGGU GACAUGA UUUAUCU   UUUUAAAG AUA  UUUG A
UUUCAU UGAGAUUUA        A
 |||||||||||||| ||| |||||||||||||| |||||| ||||||| |||||||   |||||||| |||  |||| |
|||||| |||||||||
 GGGGACUGAUUUAU UUA CUUCCUAAGACAUA UUGCCA CUGUACU AAAUAGA   GAAAUUUU UAU  AAAU U
AAAGUA ACUCUAAAU        G
-              A   A              A      -       G       AUU        A   UU    U
      C         AUAAUGGU
ADD REPLY
0
Entering edit mode

Can you format it by

```
content to be formated
```
ADD REPLY
0
Entering edit mode

" content to be formated", what that mean sir?

ADD REPLY
0
Entering edit mode

itsanju87 : It may be best to post an image here, if what you see does not convey the right information. I have not tried to change it except using the (101010) button to convert those lines to code.

ADD REPLY
0
Entering edit mode

Sir u want me to post an image? Its the one which is already there in the question section.

ADD REPLY
0
Entering edit mode

Note that: As said in the description, "RNA::HairpinFigure draws hairpin-like text figure from RNA sequence and its secondary structure in dot-bracket notation. If the hairpin have multi loops, they will be deleted and treated as a big loop, the longest stem will be the final stem."

So if the stem-loop structure is not typical hairpin-like, you may use bitmap picture produced by RNAfold.

ADD REPLY

Login before adding your answer.

Traffic: 2219 users visited in the last hour
Help About
FAQ
Access RSS
API
Stats

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.

Powered by the version 2.3.6