Question: RNA-seq fastqc error
0
gravatar for zz105
3.1 years ago by
zz10510
zz10510 wrote:

I'm running fastqc on command line, and one of the files gives me a error:

sun-java version jdk1.7.0_02 loaded
fastqc version 0.10.1 loaded
Started analysis of SRR1559140_1.fastq.gz
Approx 5% complete for SRR1559140_1.fastq.gz
Approx 10% complete for SRR1559140_1.fastq.gz
Approx 15% complete for SRR1559140_1.fastq.gz
Approx 20% complete for SRR1559140_1.fastq.gz
Approx 25% complete for SRR1559140_1.fastq.gz
Approx 30% complete for SRR1559140_1.fastq.gz
Approx 35% complete for SRR1559140_1.fastq.gz
Approx 40% complete for SRR1559140_1.fastq.gz
Approx 45% complete for SRR1559140_1.fastq.gz
Failed to process file SRR1559140_1.fastq.gz
uk.ac.babraham.FastQC.Sequence.SequenceFormatException: Midline 'CTCCTCCCAGCTGGGCTGACEGEH?CEFG<CGDFC3D@HE@ACE<E@59140.4559140.4T8TAGCTTAGEBB1:9?@DDDDDF:140.431' didn't start with '+'
    at uk.ac.babraham.FastQC.Sequence.FastQFile.readNext(FastQFile.java:142)
    at uk.ac.babraham.FastQC.Sequence.FastQFile.next(FastQFile.java:105)
    at uk.ac.babraham.FastQC.Analysis.AnalysisRunner.run(AnalysisRunner.java:76)
    at java.lang.Thread.run(Thread.java:722)

Anyone knows how to fix it? To me, this should not be the line that start with '+'

ADD COMMENTlink modified 3.1 years ago by genomax76k • written 3.1 years ago by zz10510
1

Looks like you may have a corrupt fastq record in that file. Did you use fastq-dump to get this file or some other means?

You are also using a 4-year old version of FastQC (current is v. 0.11.5). You may want to upgrade.

ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by genomax76k

yes we used fastq-dump. I do think the record is corrupted,but not sure how to fix it. Or just discard it? about the version of FastQC, it is just out of my control.

ADD REPLYlink written 3.1 years ago by zz10510
1

Best way would be to delete that record (4 lines) unless you want to try your luck with fastq-dump again to see if you can get a good copy. If this is paired end data be sure to delete the corresponding record in other file as well.

ADD REPLYlink modified 3.1 years ago • written 3.1 years ago by genomax76k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 687 users visited in the last hour