Question: error in bowtie2 alignment
0
gravatar for prasoonagar
3.4 years ago by
prasoonagar10
prasoonagar10 wrote:

Hi I have done the trimming of my reads using cutadapt after trimming i did FASTQC and find that three modules

  • Per Base Sequence Content
  • Over represented sequences
  • Sequence Length Distribution
  • Per Sequence GC Content
  • Kmer Content

they all failed. But I still went ahead and tried aligning the reads using bowtie2 with the following command

bowtie2 -p 8 -x ../hg38_index/index -X 300 --no-unal --time --no-mixed --local --dovetail --very-sensitive -1 Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R1.fastq.gz -2 Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R2.fastq.gz -S Lmin6-ChIP-41650664/Lmin6_chip.sam

I got the following error with the bowtie2

Warning: minimum score function gave negative number in --local mode for mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 2:N:0:CGATGT; setting to 0 instead
Warning: skipping mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 1:N:0:CGATGT' because length (0) <= # seed mismatches (0)
Warning: skipping mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 2:N:0:CGATGT' because length (0) <= # seed mismatches (0)
Warning: skipping mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 1:N:0:CGATGT' because it was < 2 characters long
Warning: skipping mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:18525:13236 2:N:0:CGATGT' because it was < 2 characters long
Warning: minimum score function gave negative number in --local mode for mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 1:N:0:CGATGT; setting to 0 instead
Warning: minimum score function gave negative number in --local mode for mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 2:N:0:CGATGT; setting to 0 instead
Warning: skipping mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 1:N:0:CGATGT' because length (0) <= # seed mismatches (0)
Warning: skipping mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 2:N:0:CGATGT' because length (0) <= # seed mismatches (0)
Warning: skipping mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 1:N:0:CGATGT' because it was < 2 characters long
Warning: skipping mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:16473:13334 2:N:0:CGATGT' because it was < 2 characters long
Warning: minimum score function gave negative number in --local mode for mate #1 of read 'M00546:70:000000000-ANJWB:1:1107:14918:13429 1:N:0:CGATGT; setting to 0 instead
Warning: minimum score function gave negative number in --local mode for mate #2 of read 'M00546:70:000000000-ANJWB:1:1107:14918:13429 2:N:0:CGATGT; setting to 0 instead

I tried another thing did the alignment using the untrimmed files and then the command worked perfectly. so want some suggestion if I did any thing wrong in the trimming. I used the following command for trimming

~/.local/bin/cutadapt -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT \
-o Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R1.fastq.gz \
-p Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R2.fastq.gz Lmin6-ChIP-41650664/Lmin6-ChIP_S1_L001_R1_001.fastq.gz   Lmin6-ChIP-41650664/Lmin6-ChIP_S1_L001_R2_001.fastq.gz

I will be happy if some kind suggestions are there for this problem.

Thanks

cutadapt bowtie2 alignment • 2.5k views
ADD COMMENTlink modified 3.4 years ago by Brian Bushnell17k • written 3.4 years ago by prasoonagar10
4
gravatar for Brian Bushnell
3.4 years ago by
Walnut Creek, USA
Brian Bushnell17k wrote:

I don't see a problem. You got warnings, not errors. Probably, it's because you have some very short reads after trimming; you can remove those if you want, which might make the warnings go away. With the BBMap package, you would do this:

reformat.sh in=Lmin6-ChIP-41650664/trim_cutadapt/trim_Lmin6_chip_R#.fastq.gz out=filtered#.fq.gz minlen=30
ADD COMMENTlink modified 3.4 years ago • written 3.4 years ago by Brian Bushnell17k
2

cutadapt can be run in paired end mode and told to drop pairs where one read is shorter than a certain length. I generally drop anything shorter than 15 or 20bp

ADD REPLYlink written 3.4 years ago by i.sudbery7.7k

Thanks for your suggestions i think you are right but one more query the warning says that skipping mate means they were already dropped during the alignment???

ADD REPLYlink written 3.4 years ago by prasoonagar10
1

It looks like those are length-0 reads. Not much there to align :)

ADD REPLYlink written 3.4 years ago by Brian Bushnell17k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1873 users visited in the last hour