Question: mapping transcriptome to genome to find TSS/TES/(+/-)
0
gravatar for a.rex
3.4 years ago by
a.rex220
a.rex220 wrote:

I have a transcriptome fasta file that looks like this:

>loc.00001.1 gene=loc.00001
TCATTTTCCTGGCATGGATAATTTCGCTGCAAAAGGTGTCGCACCTGAAACAGGAGAAATGCATTAGCAG
CTGTCAAATTACCACGAATTTCGGAGATTATGACGACATTTTAGAATGCGACCAATCGAAACTCGAATCG
AGAAATCTCTATGAGATATTTTCATTTCTCACATTGATAACGGGAATCGAGGAATTCCATGAGCAGAACA
TTTGGATTAAATGCTTTCACGATTTGGTGACCGATTTCATCATCTACATGCCGAAAAGGCTCAAGGATTT

I also have a genome fasta file that is around -500 contigs long.

  > contig_1  
attgacaatttaactcgagcattgttctcgtttacataacattatctcatatgtcctttaccacatctttgtagtttttctggctactcctgggataat

I want to map the transcriptome to the genome such that I can produce a resultant bed file that has the transcript ID, contig ID, TSS, TES, and +/- orientation?

Would I have to use a program like gmap? Would that give me the information I need?

mapping alignment genome • 1.1k views
ADD COMMENTlink written 3.4 years ago by a.rex220
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 808 users visited in the last hour