Question: How to get correct options for Picard's AddOrReplaceReadGroups?
gravatar for dec986
2.2 years ago by
United States
dec986160 wrote:


I've been running a drop-seq experiment, and the 2nd to last command fails:

java -Xmx4000m -jar 3rdParty/picard/picard.jar MergeBamAlignment REFERENCE_SEQUENCE=mm10/mm10.fasta UNMAPPED_BAM=unaligned_mc_tagged_polyA_filtered.bam ALIGNED_BAM=aligned.sorted.bam INCLUDE_SECONDARY_ALIGNMENTS=false PAIRED_RUN=false OUTPUT=merged.bam

This command requires two files, which I've examined with Picard's validateSamFile

for unaligned_mc_tagged_polyA_filtered.bam the error is

## HISTOGRAM    java.lang.String
Error Type    Count

and for aligned.sorted.bam, the error message is:

## HISTOGRAM    java.lang.String
Error Type    Count

which I think can be fixed by Picard's AddOrReplaceReadGroups (, but this command requires several options, which I don't know (the default options didn't work), i.e.

  RGID=4 \
  RGLB=lib1 \
  RGPL=illumina \
  RGPU=unit1 \

I don't know what to put for these options for a DropSeq experiment: How I can find these values for Picard's AddOrReplaceReadGroups?

picard • 1.3k views
ADD COMMENTlink written 2.2 years ago by dec986160

I think it would be helpful if you explained what kind of data you have, and what you are trying to accomplish. I looked up drop-seq, but it's not clear from the description, how it relates to what you are doing. Also, the exact command lines you used at every step of the way are absolutely essential to solving the problem. I only see one command, but clearly you used more.

ADD REPLYlink written 2.2 years ago by Brian Bushnell16k

Hi Brian,

Drop-Seq is a single-cell pipeline.

This is run in a series of commands, the second to last is where it fails:

/home/con/Alex/TagBamWithReadSequenceExtended SUMMARY=/mnt/data/con/Alex/unaligned_tagged_Cellular.bam_summary.txt BASE_RANGE=1-12 BASE_QUALITY=10 BARCODED_READ=1 DISCARD_READ=false TAG_NAME=XC NUM_BASES_BELOW_QUALITY=1 INPUT=/home/con/Alex/unaligned.bam OUTPUT=/mnt/data/con/Alex/unaligned_tagged_Cell.bam
/home/con/Alex/TagBamWithReadSequenceExtended SUMMARY=/mnt/data/con/Alex/unaligned_tagged_Molecular.bam_summary.txt BASE_RANGE=13-20 BASE_QUALITY=10 BARCODED_READ=1 DISCARD_READ=true TAG_NAME=XM NUM_BASES_BELOW_QUALITY=1 INPUT=/mnt/data/con/Alex/unaligned_tagged_Cell.bam OUTPUT=/mnt/data/con/Alex/unaligned_tagged_CellMolecular.bam
/home/con/Alex/FilterBAM TAG_REJECT=XQ INPUT=/mnt/data/con/Alex/unaligned_tagged_CellMolecular.bam OUTPUT=/mnt/data/con/Alex/unaligned_tagged_filtered.bam
/home/con/Alex/TrimStartingSequence OUTPUT_SUMMARY=/mnt/data/con/Alex/adapter_trimming_report.txt SEQUENCE=AAGCAGTGGTATCAACGCAGAGTGAATGGG MISMATCHES=0 NUM_BASES=5 INPUT=/mnt/data/con/Alex/unaligned_tagged_filtered.bam OUTPUT=/mnt/data/con/Alex/unaligned_tagged_trimmed_smart.bam
/home/con/Alex/PolyATrimmer OUTPUT=/mnt/data/con/Alex/unaligned_mc_tagged_polyA_filtered.bam OUTPUT_SUMMARY=/mnt/data/con/Alex/polyA_trimming_report.txt MISMATCHES=0 NUM_BASES=6 INPUT=/mnt/data/con/Alex/unaligned_tagged_trimmed_smart.bam
java -Xmx500m -jar /home/con/Alex/3rdParty/picard/picard.jar SamToFastq INPUT=/mnt/data/con/Alex/unaligned_mc_tagged_polyA_filtered.bam FASTQ=/mnt/data/con/Alex/unaligned_mc_tagged_polyA_filtered.fastq
/opt/star/STAR --genomeDir /home/con/GENE_DATA/mm10 --outSAMattributes All --runThreadN 5 --outFileNamePrefix /mnt/data/con/Alex/star. --readFilesIn /mnt/data/con/Alex/unaligned_mc_tagged_polyA_filtered.fastq
java -Dsamjdk.buffer_size=131072 -XX:GCTimeLimit=50 -XX:GCHeapFreeLimit=10 -Xmx4000m -jar /home/con/Alex/3rdParty/picard/picard.jar SortSam INPUT=/mnt/data/con/Alex/star.Aligned.out.sam OUTPUT=/mnt/data/con/Alex/aligned.sorted.bam SORT_ORDER=queryname TMP_DIR=/mnt/data/con/Alex
java -Xmx4000m -jar /home/con/Alex/3rdParty/picard/picard.jar MergeBamAlignment REFERENCE_SEQUENCE=/home/con/Alex/mm10/mm10.fasta UNMAPPED_BAM=/mnt/data/con/Alex/unaligned_mc_tagged_polyA_filtered.bam ALIGNED_BAM=/mnt/data/con/Alex/aligned.sorted.bam INCLUDE_SECONDARY_ALIGNMENTS=false PAIRED_RUN=false OUTPUT=/mnt/data/con/Alex/merged.bam
/home/con/Alex/TagReadWithGeneExon O=/mnt/data/con/Alex/star_gene_exon_tagged.bam ANNOTATIONS_FILE=/home/con/Alex/mm10/mm10.refFlat TAG=GE CREATE_INDEX=true INPUT=/mnt/data/con/Alex/merged.bam
ADD REPLYlink written 2.2 years ago by dec986160
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2203 users visited in the last hour