Question: PAML(codeml) reading sequences EOF
0
gravatar for Feng
3.8 years ago by
Feng0
US
Feng0 wrote:

Hi all,

I was trying to use PAML (codeml) to calculate dn/ds i converted aligned fasta file to phylip format. but it keeps giving me error. so my output mlc is empty. I pasted the error as below, does anyone know why? thank you!

ns = 7 ls = 22105 Reading sequences, sequential format.. Reading seq # 7: TGCGAGTAAACTCGCCATTCTGCCCCCCATCGACTTGCCACCAATGACCA
EOF at site 21756, seq 7

alignment sequence • 1.8k views
ADD COMMENTlink modified 5 months ago by Biostar ♦♦ 20 • written 3.8 years ago by Feng0

Could it be a windows/unix issue? If you work in linux and edited the file in windows you might try using dos2unix

ADD REPLYlink written 3.8 years ago by Fabio Marroni2.6k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1355 users visited in the last hour