Question: Translate nucleotide to amino acid (not including intron)
0
gravatar for nut_B
2.8 years ago by
nut_B10
nut_B10 wrote:

Hello,

If I want to translate nucleotide to amino acid but this amino acid have not intron included. I would like to translate because I would like to use this translated amino acid to blastp for identify function in my interested organism. If anyone know any tool or another ways that can do like above, please let me know.

Thank you advance,

PS. In fundamental knowledge, I would like to annoy who one can translate this nucleotide sequence to amino acid sequence. For example for me. Because I do not sure, I understand right, or not?

ATGTCAGAATCTTCAAACGCATCGCCTAATGCCAGCCCCTCTGTATCGGCCACTCGCGGAACTAGTCACAACACCCAGGCTATAACGAGCGTGCCAGGCCGCTACATTCATCCATACAAGCTAAAGAACATGCTTCAGGCTCGGTTTGGCGACAATTACTCGGTTGAGATACGCGCCGATAATTACACAATCTCGGCTGGGCATAAGATTCCATACACCGATATAAAGAGGTGCTATTGA

Could everyone translate above nucleotide sequence to amino acid sequence for me, please? For example that How can I know which tool can translate with not include INTRON for me?

ADD COMMENTlink modified 2.8 years ago by Asaf6.4k • written 2.8 years ago by nut_B10
1
gravatar for Asaf
2.8 years ago by
Asaf6.4k
Israel
Asaf6.4k wrote:

It's better to use blastx if you have unspliced DNA. You'll find the regions matching the target protein.

ADD COMMENTlink written 2.8 years ago by Asaf6.4k

Hello Asaf,

I would like to translate it because I have to blastp with another result from another ORFs prediction tool. Result from other ORFs prediction tool was amino acid sequence. But this answer is better way for me. Thank you very much.

Thank you very much.

ADD REPLYlink written 2.8 years ago by nut_B10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1821 users visited in the last hour