Question: How to use output from GeneMark-ES to identify function?
0
gravatar for nut_B
2.2 years ago by
nut_B10
nut_B10 wrote:

Hello everyone,

I would like to ask anyone who know about How to use result from GeneMark-ES program to identify function? For now I already have a result like below of this post. And It's include Nucleotide sequences output but I would like to use Amino acid sequences to identify function. That's the problem that I would like to ask suggestion by anyone who know to solve this problem. I cannot translate those Nucleotide sequence to Amino acid sequence because It's still include intron when just translate Nucleotide sequence to Amino acid sequence.

Output from GeneMark-ES : *Eukariotyc GeneMark.hmm version 3.49 Sequence name: /storage/home/nuthatai.sut/CallORF_Tool/gm_et_linux_64/gmes_petap/output/data/dna.fa_15 FASTA defline: >dna.fa_15 15_dna 1 30316 Sequence length: 30316 bp G+C content: 27.92% Matrices file: /storage/home/nuthatai.sut/CallORF_Tool/gm_et_linux_64/gmes_petap/output/gmhmm.mod Tue Oct 25 17:52:02 2016 Predicted genes/exons Gene Exon Strand Exon Exon Range Exon Start/End # # Type Length Frame 1 2 - Terminal 6981 7014 34 3 3 - - 1 1 - Initial 7171 7244 74 2 1 - - 2 2 - Terminal 16420 16424 5 3 2 - - 2 1 - Initial 16476 16509 34 1 1 - - 3 1 + Initial 26431 26436 6 1 3 - - 3 2 + Terminal 26642 26644 3 1 3 - -

nucleotide sequence of predicted genes

gene_1|GeneMark.hmm|108_nt ATGTCATCCCTTACTTTGCATCAACAGGCCTACTACACGATAGCACCCGCCGGAATGTCC ATTTGGACTGAACGTAAGAAAGGCGACGTCATGACCAAGACAGTATAA gene_2|GeneMark.hmm|39_nt ATGTTTCTACCAAACATCGGATTTAACTCACCAGGATGA gene_3|GeneMark.hmm|9_nt ATGAATTGA

end nucleotide sequence*

Thank you for advance everyone

genemark-es annotation • 1.4k views
ADD COMMENTlink modified 2.2 years ago by h.mon24k • written 2.2 years ago by nut_B10

blastx it on NCBI's site...? https://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastx&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome

And be aware, GeneMark only predicts CDS sequences. There's no guarantee that actually is one - and if I'm reading your copied sequences correctly, GeneMark thinks it found 3 that are 108nt or less? I'd say its pretty unlikely that anything that short codes for something meaningful.

ADD REPLYlink modified 2.2 years ago • written 2.2 years ago by jrj.healey12k

I have another CDs predictor that another tool have Amino acid sequence. That's reason why I would like to convert GeneMark-ES output to Amino acid sequences. And I would like to thank you for your help, if you have any suggestion please let's me know.

Thank you

ADD REPLYlink written 2.2 years ago by nut_B10

If you just need a tool that does translation for you, use ExPASy: http://web.expasy.org/translate/

Again, note that this is not an exact science for unknown organisms, you'll be relying on a generic version of whatever translation table you choose which may not be exactly right for your organism - whatever it is.

ADD REPLYlink modified 2.2 years ago • written 2.2 years ago by jrj.healey12k

Thank you for your suggestion.

ADD REPLYlink written 2.2 years ago by nut_B10
1
gravatar for h.mon
2.2 years ago by
h.mon24k
Brazil
h.mon24k wrote:

Did you try the get_sequence_from_GTF.pl script, which comes with GeneMark-ES?

Input: gene coordinates in GTF format and sequence in FASTA format

Output: nucleotide and protein sequences of genes

ADD COMMENTlink modified 2.2 years ago • written 2.2 years ago by h.mon24k

I will try to use this perl script. Thank you for your suggestion.

ADD REPLYlink written 2.2 years ago by nut_B10
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1883 users visited in the last hour