Question: Novoalign: right index? and SAM output
gravatar for maude
3.3 years ago by
maude0 wrote:

Hi everyone! I'm trying to map sequencing data (Illumina, paired-end) with Novoalign but I'have some troubles to understand the results. First, I've constructed the index by using :

 '/home//Desktop/novocraft/novoindex' 'celegans.nix' '/home//Desktop/novocraft/c_elegans.WS220.genomic.fa'  
# novoindex (3.7) - Universal k-mer index constructor.
# (C) 2008 - 2011 NovoCraft Technologies Sdn Bhd
# novoindex celegans.nix /home//Desktop/novocraft/c_elegans.WS220.genomic.fa 
# Creating 32 indexing threads.
# Building with 12-mer and step of 1 bp.
# novoindex construction dT = 2.8s
# Index memory size   0.483Gbyte.
# Done.

I don't know if it's normal or not, but when I try to have a look on this nix file, this is what I have:

head '/home//celegans.nix' 


Anyway, I decided to continue the analysis and tried to map paired-end fragments:

/home//Desktop/novocraft/novoalign' -d '/home//Desktop/celegans.nix' -f '/home/Desktop/analysis/29t1/29t1_L2_R1_001_bRiyPfyeAal4.fastq' '/home//Desktop/analysis/29t1/29t1_L2_R2_001_AplPFFbRfW86.fastq' -o SAM > alignement_29.sam

head '/home/alignement_29.sam':

@HD VN:1.0  SO:unsorted
@PG ID:novoalign    PN:novoalign    VN:V3.07.00 CL:novoalign -d /home/Desktop/analysis/celegans.nix -f /home/Desktop/analysis/29t1/29t1_L2_R1_001_bRiyPfyeAal4.fastq /home/Desktop/analysis/29t1/29t1_L2_R2_001_AplPFFbRfW86.fastq -o SAM
@SQ SN:CHROMOSOME_I LN:15072423 AS:celegans
@SQ SN:CHROMOSOME_II    LN:15279345 AS:celegans
@SQ SN:CHROMOSOME_III   LN:13783700 AS:celegans
@SQ SN:CHROMOSOME_IV    LN:17493793 AS:celegans
@SQ SN:CHROMOSOME_V LN:20924149 AS:celegans
@SQ SN:CHROMOSOME_X LN:17718866 AS:celegans
@SQ SN:CHROMOSOME_MtDNA LN:13794    AS:celegans
HWI-ST865:528:HCYNTBCXX:2:1101:1307:2105    99  CHROMOSOME_III  4080132 70  25M =   4080462 355 CCGCAATTTGTCTTCAACTCTTCGA   <0BD0<CCFHIIHHFEGHIHIII1G   PG:Z:novoalign  AS:i:0  UQ:i:0  NM:i:0  MD:Z:25 PQ:i:1  SM:i:70 AM:i:70
HWI-ST865:528:HCYNTBCXX:2:2216:16878:99707  83  CHROMOSOME_II   1291022070  22M3S   =   12910087    -155    GCAACTCAAAAGAAGTTCAGACACN   1<<<1<1<<D<<GD<<?GD1<<0<#   PG:Z:novoalign  AS:i:68 UQ:i:68 NM:i:2  MD:Z:4A1A15 PQ:i:99 SM:i:28 AM:i:28
HWI-ST865:528:HCYNTBCXX:2:2216:16878:99707  163 CHROMOSOME_II   1291008770  25M =   12910220    155 ATTCCAGACGCGAATGGATTGCTAT   00<<<D11<<</CEHF<C<<<<1<1   PG:Z:novoalign  AS:i:30 UQ:i:30 NM:i:1  MD:Z:8A16   PQ:i:99 SM:i:61 AM:i:28

Does anyone know if these results are normal? I want to convert this SAM file on a BED file but it doesn't work and I don't know if maybe this is because this SAM file is wrong.

Thanks a lot for your help! Maude

mapping sam ngs novoalign • 1.4k views
ADD COMMENTlink modified 3.3 years ago by Devon Ryan95k • written 3.3 years ago by maude0

Index files are binary so what you are seeing with the head command is logical (you can't view binary files that way). Your alignment sam file looks fine as well.

I want to convert this SAM file on a BED file but it doesn't work and I don't know if maybe this is because this SAM file is wrong

Did you mean to say you want to convert it to BAM? What command did you try/use?

ADD REPLYlink modified 3.3 years ago • written 3.3 years ago by genomax84k

Thank you for your answer. No I'm trying to convert it to BED. For this I'm using sam2bed from Bedops. But in fact, now I'm realizing that I've skipped some steps and that I can't go directly to this format... I will work a little bit more on that. Thank you again!

ADD REPLYlink written 3.3 years ago by maude0
Please log in to add an answer.


Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1203 users visited in the last hour