Question: miR KEGG enrichment in Arabidopsis
0
gravatar for jnf3769
6 months ago by
jnf376940
United States
jnf376940 wrote:

Hello all, I have a list of known miRNA's from an experiment in Arabidopsis (example: ath-MIR166a) and I am looking to find out what biochemical pathways they interact with, with KEGG or reactome.db preferably. I have preformed this analysis in humans several times with no issues. If anybody could push me in the right direction, I would appreciate it, especially if it is a solution in R.

Thank you so much for your time and attention to this matter!

ADD COMMENTlink written 6 months ago by jnf376940

Hi JNF3769, I am also working on miRNA's. I have single end fastq files from sequencing centre. I trimmed my fastq files only at the 3'end. The reason for trimming is, generally miRNAs are smaller, so the sequencing machine will sequence the adapter region.

Illumina-SmallRNAAdapter.fa

RNA 3 Adapter TGGAATTCTCGGGTGCCAAGG

Did you trim any other adapters or primers?

I noticed that in miRBase all mature.fasta file has U base instead of T. But my reads have base T in them.

Did you change the base U to T in mature.fa file in order to do alignment?

ADD REPLYlink modified 6 months ago • written 6 months ago by bioinforesearchquestions90

I did not need to do alignment or quality control of the sequencing data--it was handed off to me by a legacy researcher and I am more concerned with a qualitative assessment, rather than a quantitative one. I intend to go back and check his work after this to make sure we get the same results, but that is a problem for future me.

ADD REPLYlink written 6 months ago by jnf376940

Thanks, JNF. Currently, I am looking at the preprocessing step. Would you be able to check with that researcher about the above queries?

ADD REPLYlink written 6 months ago by bioinforesearchquestions90
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 650 users visited in the last hour