Question: Tophat 2.1.1 failing to recognize fasta file
0
gravatar for kallen83
2.6 years ago by
kallen8310
kallen8310 wrote:

I'm trying to align a set of reads in fasta format to a reference genome (indexed with bowtie2-build), but tophat is failing with the following error:

tophat thc_genomic 5369.fa

[2017-04-20 10:14:53] Beginning TopHat run (v2.1.1)
-----------------------------------------------
[2017-04-20 10:14:53] Checking for Bowtie
          Bowtie version:    2.3.1.0
[2017-04-20 10:14:53] Checking for Bowtie index files (genome)..
[2017-04-20 10:14:53] Checking for reference FASTA file
[2017-04-20 10:14:53] Generating SAM header for thc_genomic
[2017-04-20 10:14:53] Preparing reads
     left reads: min. length=95, max. length=101, 4488 kept reads (0 discarded)
[2017-04-20 10:14:54] Mapping left_kept_reads to genome thc_genomic with Bowtie2 
    [FAILED]
Error running bowtie:
Error: reads file does not look like a FASTQ file
Error: Encountered exception: 'Unidentified exception'
Command: /usr/local/bin/../Cellar/bowtie2/2.3.0/bin/bowtie2-align-s --wrapper basic-0 -k 20 -D 15 -R 2 -N 0 -L 20 -i S,1,1.25 --gbar 4 --mp 6,2 --np 1 --rdg 5,3 --rfg 5,3 --score-min C,-14,0 -p 1 --sam-no-hd -x thc_genomic - 
(ERR): bowtie2-align exited with value 1

(sorry the cut and paste is making that a little hard to read).

I agree that the input file doesn't look like fastq because actually, it's not. It's a fasta file, and the docs say that tophat now auto-detects fasta and behaves accordingly. I don't see a command line flag to force it to treat the input file as fasta -- what am I missing?

My input read file looks like this:

>gnl|SRA|SRR352208.104462060.1 HWI-ST600:7:68:16692:76873
TAAGTTTAATAAATCTAAGTCAAAGTTCAATATCGGTCCCTTCCGATGCATACTCCATGCATCCAACCTG
AGCTTTACTTTAACCAATGCTCTGGAAAGAA

>gnl|SRA|SRR352208.103232838.2 HWI-ST600:7:67:16843:150317
AACTAGGCGATATTGACTTGAATAGATATTACGGTAAGTTTAATAAATCTAAGTCAAAGTTCAATATCGG
TCCCTTCCGATGCATACTCCATGCATCCAAC

Surely I'm missing a command line flag, or does tophat need the fasta id line to be formatted a specific way?

Thanks

rna-seq alignment • 1.3k views
ADD COMMENTlink modified 2.6 years ago by genomax74k • written 2.6 years ago by kallen8310

I have formatted your code correctly. In future use the icon shown below (after highlighting the text you want to format as code) when editing (Screenshot courtsey of @Wouter).

ScreenCap

ADD REPLYlink written 2.6 years ago by genomax74k

I know by personal experience that Tophat2 is picky about read names. Try with a small subset of reads: rename them like ">read1" to ">readN" and see if it works! Perhaps it doesn't like the illumina read name format in a FASTA but only in a FASTQ.

ADD REPLYlink written 2.6 years ago by Macspider3.0k

Yeah, I tried that, with the id lines changed just the way you suggested, but I get the same result.

ADD REPLYlink written 2.6 years ago by kallen8310

Are those actual white lines between your fasta records?

You should also know that Tophat is no longer the "advisable" tool for RNA-seq analysis. The software is deprecated/ in low maintenance and should be replaced by HISAT2, StringTie and ballgown. See this paper: Transcript-level expression analysis of RNA-seq experiments with HISAT, StringTie and Ballgown. (If you can't get access to that publication, let me know and I'll -cough- help you.) There are also other alternatives, including alignment with STAR and bbmap,...

ADD REPLYlink written 2.6 years ago by WouterDeCoster42k
1

the blank line between the two fasta records is an artifact of cutting and pasting from a terminal window. It's not present in the actual fasta file.

But your second point is very interesting, I didn't know the field moved on, I'm going to read that paper right now (and I have -cough- ways -cough- of getting around most access restrictions, but I appreciate the offer).

Thanks for the advice.

ADD REPLYlink written 2.6 years ago by kallen8310

Any splice-aware aligner (BBMap, STAR are good options) along with featureCounts from Subread package would be a great option to look into.

ADD REPLYlink written 2.6 years ago by genomax74k
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 2068 users visited in the last hour