Question: (Closed) Error: reads file does not look like a FASTQ file
0
gravatar for Agaz Hussain Wani
24 months ago by
India
Agaz Hussain Wani40 wrote:

I am trying to use bowtie tool to align ecoli paired end reads. My files extension is .fq. The reads look like

@r0/1
TATTCTTCCGCATCCTTCATACTCCTGCCGGTCAG
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
@r1/1
TGATAGATCTCTTTTTTCGCGCCGACATCTACGCC
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
@r2/1
CACGCCCTTTGTAAGTGGACATCACGCCCTGAGCG
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
@r3/1
CGATGCAGATGCGTACCACCTGGACCAGGCCTTTC
+
EDCCCBAAAA@@@@?>===<;;9:99987776554

and I think the reads are in fastq format. But I get the error: on using the following command

bowtie index -1 file1 -2 file2 output

Error: reads file does not look like a FASTQ file

I am not sure what is going wrong.

alignment software error • 2.8k views
ADD COMMENTlink modified 24 months ago by genomax65k • written 24 months ago by Agaz Hussain Wani40
1

Looking at the Bowtie source code here, this error is thrown whenever the first non-empty line does not start with '@'. Are you sure this is what your FASTQ files look like?

ADD REPLYlink modified 24 months ago • written 24 months ago by jonasmst280

I don't think this is a real file, the quality values are all identical. How was the input generated?

ADD REPLYlink written 24 months ago by Michael Dondrup46k

About input generation, I am not sure, but the ecoli reads come with bowtie software package.

ADD REPLYlink written 24 months ago by Agaz Hussain Wani40
1

I think you have to paste the real file content and the real command, because there is where we can spot problems! This looks like a dummy file (qualities are identical and read names are not as they usually are -> coded depending on the technology). Moreover, the command as you wrote it looks correct in syntax but we have to see the real one to understand!

ADD REPLYlink modified 24 months ago • written 24 months ago by Macspider2.8k

Above show command is real and the reads are paired end reads given as sample dataset in bowtie software package. @ as read name is used by illumina technology.

ADD REPLYlink written 24 months ago by Agaz Hussain Wani40

Please provide the full command and possibly also your real input and the error message.

ADD REPLYlink written 24 months ago by Michael Dondrup46k

Hello hussain.kh438!

We believe that this post does not fit the main topic of this site.

Cannot reproduce

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

ADD REPLYlink written 24 months ago by Michael Dondrup46k
0
gravatar for genomax
24 months ago by
genomax65k
United States
genomax65k wrote:

Since you are trying to index a genome you need to provide a fasta genome reference (not R1/R2 data files). The reference genome file included is in bowtie/1.2.0/src/bowtie-1.2/genomes/NC_008253.fna in bowtie package. That said, the package also includes premade indexes in /bowtie/1.2.0/src/bowtie-1.2/indexes/.

ADD COMMENTlink written 24 months ago by genomax65k
1

That is already done by bowtie-build [options]* <reference_in> <ebwt_base>. I suspect the read files has some problem, even though the files are in FASTQ format. I tested for some other files and it worked fine.

ADD REPLYlink written 24 months ago by Agaz Hussain Wani40
1

There is no problem with the files.

bowtie /path_to/bowtie-1.2/indexes/e_coli -1 /path_to/bowtie-1.2/reads/e_coli_1000_1.fq -2 /path_to/bowtie-1.2/reads/e_coli_1000_2.fq test.sam

works fine.

ADD REPLYlink modified 24 months ago • written 24 months ago by genomax65k
1

Got a new copy of files, worked. I think something changed while running some command. Thanks, finally done :)

ADD REPLYlink written 24 months ago by Agaz Hussain Wani40

The reads file looks like it has issues, if you see the qualities they all are the same even if the bases called are different.

ADD REPLYlink written 24 months ago by Macspider2.8k

This is a dummy data set included with bowtie distribution.

ADD REPLYlink written 24 months ago by genomax65k
Please log in to add an answer.
The thread is closed. No new answers may be added.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 657 users visited in the last hour