Question: (Closed) Error: reads file does not look like a FASTQ file
0
gravatar for AHW
2.7 years ago by
AHW40
India
AHW40 wrote:

I am trying to use bowtie tool to align ecoli paired end reads. My files extension is .fq. The reads look like

@r0/1
TATTCTTCCGCATCCTTCATACTCCTGCCGGTCAG
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
@r1/1
TGATAGATCTCTTTTTTCGCGCCGACATCTACGCC
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
@r2/1
CACGCCCTTTGTAAGTGGACATCACGCCCTGAGCG
+
EDCCCBAAAA@@@@?>===<;;9:99987776554
@r3/1
CGATGCAGATGCGTACCACCTGGACCAGGCCTTTC
+
EDCCCBAAAA@@@@?>===<;;9:99987776554

and I think the reads are in fastq format. But I get the error: on using the following command

bowtie index -1 file1 -2 file2 output

Error: reads file does not look like a FASTQ file

I am not sure what is going wrong.

alignment software error • 3.8k views
ADD COMMENTlink modified 2.7 years ago by genomax76k • written 2.7 years ago by AHW40
1

Looking at the Bowtie source code here, this error is thrown whenever the first non-empty line does not start with '@'. Are you sure this is what your FASTQ files look like?

ADD REPLYlink modified 2.7 years ago • written 2.7 years ago by jonasmst300

I don't think this is a real file, the quality values are all identical. How was the input generated?

ADD REPLYlink written 2.7 years ago by Michael Dondrup47k

About input generation, I am not sure, but the ecoli reads come with bowtie software package.

ADD REPLYlink written 2.7 years ago by AHW40
1

I think you have to paste the real file content and the real command, because there is where we can spot problems! This looks like a dummy file (qualities are identical and read names are not as they usually are -> coded depending on the technology). Moreover, the command as you wrote it looks correct in syntax but we have to see the real one to understand!

ADD REPLYlink modified 2.7 years ago • written 2.7 years ago by Macspider3.0k

Above show command is real and the reads are paired end reads given as sample dataset in bowtie software package. @ as read name is used by illumina technology.

ADD REPLYlink written 2.7 years ago by AHW40

Please provide the full command and possibly also your real input and the error message.

ADD REPLYlink written 2.7 years ago by Michael Dondrup47k

Hello hussain.kh438!

We believe that this post does not fit the main topic of this site.

Cannot reproduce

For this reason we have closed your question. This allows us to keep the site focused on the topics that the community can help with.

If you disagree please tell us why in a reply below, we'll be happy to talk about it.

Cheers!

ADD REPLYlink written 2.7 years ago by Michael Dondrup47k
0
gravatar for genomax
2.7 years ago by
genomax76k
United States
genomax76k wrote:

Since you are trying to index a genome you need to provide a fasta genome reference (not R1/R2 data files). The reference genome file included is in bowtie/1.2.0/src/bowtie-1.2/genomes/NC_008253.fna in bowtie package. That said, the package also includes premade indexes in /bowtie/1.2.0/src/bowtie-1.2/indexes/.

ADD COMMENTlink written 2.7 years ago by genomax76k
1

That is already done by bowtie-build [options]* <reference_in> <ebwt_base>. I suspect the read files has some problem, even though the files are in FASTQ format. I tested for some other files and it worked fine.

ADD REPLYlink written 2.7 years ago by AHW40
1

There is no problem with the files.

bowtie /path_to/bowtie-1.2/indexes/e_coli -1 /path_to/bowtie-1.2/reads/e_coli_1000_1.fq -2 /path_to/bowtie-1.2/reads/e_coli_1000_2.fq test.sam

works fine.

ADD REPLYlink modified 2.7 years ago • written 2.7 years ago by genomax76k
1

Got a new copy of files, worked. I think something changed while running some command. Thanks, finally done :)

ADD REPLYlink written 2.7 years ago by AHW40

The reads file looks like it has issues, if you see the qualities they all are the same even if the bases called are different.

ADD REPLYlink written 2.7 years ago by Macspider3.0k

This is a dummy data set included with bowtie distribution.

ADD REPLYlink written 2.7 years ago by genomax76k
Please log in to add an answer.
The thread is closed. No new answers may be added.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 887 users visited in the last hour