Question: Trimmomatic adapter file TruSeq3-PE-2.fa
0
gravatar for candida.vaz
17 months ago by
Singapore
candida.vaz0 wrote:

Dear all,

I am using Trimmomatic for adapter removal for my Truseq paired-end data (150bp). According to the Trimmomatic provided adapter file "TruSeq3-PE-2.fa" the reverse complements of index adapter sequence is used for trimming reads from R2 file and the universal adapter is used for trimming reads from R1 file.

PrefixPE/1 TACACTCTTTCCCTACACGACGCTCTTCCGATCT

PrefixPE/2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

PE1 TACACTCTTTCCCTACACGACGCTCTTCCGATCT

PE1_rc AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA

PE2 GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT

PE2_rc AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC

However, it looks like that for my data the actual sequences of the index adapter is in the R1 file and the reverse complement of the universal adapter is in the R2 file. This information was also provided to me by Illumina support team. Therefore I prepared my adapter file as follows:

PrefixPE/1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG (index adapter)

PrefixPE/2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT ( reverse complement of universal adapter)

PE1 AGATCGGAAGAGCACACGTCTGAACTCCAGTCACATCACGATCTCGTATGCCGTCTTCTGCTTG

PE1_rc CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (revcomp of PE1)

PE2 AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT

PE2_rc AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (revcomp of PE2)

Please let me know if this adapter file I prepared is fine or is the Trimmomatic adapter file needs to be used always.

Thanks, Candida

sequencing rna-seq • 5.5k views
ADD COMMENTlink modified 17 months ago by agoel30 • written 17 months ago by candida.vaz0

Consider using bbduk.sh from BBMap suite and the adapters.fa file included in the resources directory. No need to worry about orientation.

ADD REPLYlink modified 17 months ago • written 17 months ago by genomax57k

You can use cutadapt link. Might be useful for you.

ADD REPLYlink written 17 months ago by agoel30

Moved this to a comment since it is not an answer for the original question.

ADD REPLYlink written 17 months ago by genomax57k
1
gravatar for cschu181
17 months ago by
cschu1811.4k
cschu1811.4k wrote:

Tony Bolger (one of the Trimmomatic devs) once told me that you need to specify exactly the sequences that you're looking for, Trimmomatic will not automatically check for the reverse complement. If that is still true (and I don't see a reason why it shouldn't), then your approach of adding the reverse complements should work just fine.

ADD COMMENTlink written 17 months ago by cschu1811.4k

Yes it is also mentioned in the manual that one needs to mention the reverse complement. My doubt is regarding the universal usage of the Trimmomatic provided adapter file "TruSeq3-PE-2.fa". Should this file be used always? Or was I right in making my own file according to the adapters in my file. Just a bit doubtful. Is there any way to check?

Regards, Candida

ADD REPLYlink written 17 months ago by candida.vaz0

You were right to make your own version.

ADD REPLYlink written 17 months ago by cschu1811.4k

Used it also recently, still specified the reverse complement, so I guess that this is still on.

ADD REPLYlink written 17 months ago by Macspider2.6k

So did you have the "TACACTCTTTCCCTACACGACGCTCTTCCGATCT" adapter seq in your R1 file and

"GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT" seq in your R2 file?

Could you check taking the top 200~ sequences of both your files

ADD REPLYlink written 17 months ago by candida.vaz0

Hi Macspider,

Could you please share the adapter file you used for removing adapters from Truseq PE data using Trimmomatic. Was your file similar to mine or did you use the "TruSeq3-PE-2.fa". Though the sequences and their reverse complements are the same, but if you notice, they are for opposite files! Though I tried both the adapter files and the adapters got trimmed in both the cases!! so was just wondering how that happened.

ADD REPLYlink written 17 months ago by candida.vaz0

I used the default one provided from Trimmomatic! "TruSeq2-PE.fa", I think was the name, but is in the /dir of Trimmomatic.

ADD REPLYlink written 17 months ago by Macspider2.6k

Oh I see! But did you check your R1 and R2 files for the presence of the adapters mentioned by Illumina. My only issue is the sequence mentioned in the trimmomatic adapter file as 2 is actually for R1 and vice versa.

ADD REPLYlink written 17 months ago by candida.vaz0
Please log in to add an answer.

Help
Access

Use of this site constitutes acceptance of our User Agreement and Privacy Policy.
Powered by Biostar version 2.3.0
Traffic: 1674 users visited in the last hour